Showing posts with label 2011. Show all posts
Showing posts with label 2011. Show all posts

Saturday, November 4, 2017

Jurnal Indonesia 004

upaya peningkatan motivasi hasil belajar kimia siswa melalui penerapan model pembelajaran kooperatif konsultatif berbantuan kartu kompetitif classroom action research analisis distribusi pendapatan nelayan kota bengkulu kasus kelurahan pasar bengkulu kecamatan teluk segara kota bengkulu strategi pengembangan jasa pariwisata kota bengkulu suntingan teks naskah pengobatan masyarakat serawai koleksi museum negeri bengkulu pengaruh kepemimpinan motivasi kerja terhadap kinerja pegawai pada dinas pertambangan energi sumber daya mineral kabupaten bengkulu selatan inventarisasi sebaran dominansi jenis jenis lobster perairan pulau tikus bengkulu upaya peningkatan pengetahuan awal hasil belajar aktivitas siswa melalui metode pemberian tugas pra pembelajaran berupa ringkasan pada pokok bahasan reaksi redoks kelas xe sma negeri 6 kota bengkulu classroom action research pemanfaatan gel tanaman lidah buaya aloe vera pupuk kcl sebagai jembatan garam pokok bahasan elektrokimia pada pembelajaran kimia kelas xii sma negeri 4 kota bengkulu analisis usaha gula kelapa desa pasar kerkap kecamatan air napal bengkulu utara tentang perencanaan pada program pendidikan keterampilan hidup life skills usaha ikan gurami deskriptif kualitatif kelurahan padang serai kecamatan kampung melayu kota bengkulu analisis faktor faktor yang mempengaruhi tingkat kemiskinan propinsi bengkulu peramalan produksi penjualan serta risiko usaha perkebunan kakao pt buana estate ketahun ii bengkulu penerapan pembelajaran kooperatif tipe think pair share tps dengan menggunakan media hand out meningkatkan hasil belajar kimia siswa kelas x2 sma negeri 8 kota bengkulu classroom action research class opening activities by senior and junior english teachers at sman in curup in academic year 2006 2007 upaya peningkatan hasil belajar fisika siswa dengan menerapakan model clis children s learning in science pada konsep alat alat optik kelas viii d smpn 1 talang empat bengkulu utara classroom action research pengembangan instrumen penilaian unjuk kerja performance assesment serta aplikasinya pembelajaran matematika luar kelas outdoor mathematics siswa smp negeri 15 kota bengkulu rice brand quality of several rice varieties in north bengkulu analisis kualitas buku ajar matematika smp kelas viii semester 2 kota bengkulu analisis quality function deployment pada pengemasan pemasaran informasi oleh pelaku internet yahoo google kemampuan menulis karangan eksposisi siswa kelas x sma negeri 1 padang ulak tanding kabupaten rejang lebong pengaruh minat belajar kimia penguasaan operasi hitung terhadap penguasaan konsep kesetimbangan kimia kelas xi semester i sma negeri i putri hijau bengkulu utara pengaruh penyajian cerita contoh lingkungan pada tahap awal pembelajaran biologi terhadap motivasi belajar siswa smpn 1 talang empat pengaruh penyesuaian harga price adjustmentdan service encounter terhadap loyalitas tokoritel kasus konsumen yang berbelanja toko khatulistiwa pengaruh pembelajaran dengan metode resitasi terhadap hasil belajar fisika sma pembangunan bengkulu peningkatan kemampuan menulis kalimat pengalaman yang berkesan dengan latihan terbimbing kelas vii 4 smpn 3 kota bengkulu penelitian tindakan kelas pengaruh work family conflict motivasi serta insentif terhadap kinerja pegawai rektorat universitas bengkulu penerapan model pembelajaran interaktif akademis emosional mpiae kelas viii d smp negeri 15 kota bengkulu pada pokok bahasan cahaya meningkatkan hasil belajar classroom action research deskripsi gaya kepemimpinan lingkungan kerja serta keterkaitannya dengan kepuasan kerja pegawai kantor dinas perindustrian perdagangan propinsi bengkulu pengaruh kompensasi promosi jabatan terhadap motivasi kerja pegawai pada biro umum perlengkapan setda provinsi bengkulu analisis kepuasan pelanggan pada perusahaan jasa warnet ampera kota bengkulu factors that trigger students negative attitude toward english subject at smu n 1 talang empat upaya meningkatkan kemampuan siswa menyelesaikan soal soal essay kaya konteks melalui metode problem solving pada konsep keseimbangan benda tegar kelas xi ipa 2 sma negeri 1 talang empat classroon action research analisis faktor faktor yang mempengaruhi pendapatan usaha gerai telepon seluler kota bengkulu bimbang adat pada masyarakat serawai reaksi pasar terhadap pengumuman kenaikan penurunan dividen pengaruh penyuluhan kesehatan lingkungan terhadap perubahan sikap masyarakat desa batu raja kecamatan pondok kelapa kabupaten bengkulu utara pengembangan kreatifitas anak pada pendidikan anak usia dini paud pelita hati kota bengkulu upaya peningkatan hasil belajar pada konsep energi usaha dengan pendekatan konstruktivisme melalui metode inkuiri pada siswa kelas vii2 smpn 6 bengkulu classroom action research pengaruh lingkungan kerja disiplin kerja kompensasi motivasi terhadap prestasi kerja a comparison of the effectiveness of folktale and nonfolktale texts in student s reading comprehension the study is in the second year s students of the sltpn i pondok kelapa pengujian empiris pecking order theory terhadap leverage pada perusahaan go public bursa efek jakarta terhadap siklus hidup perusahaan distribusi kelimpahan keanekaragaman jenis ikan sungai air kotok kabupaten lebong bengkulu isolasi minyak karakterisasi metil ester dari batok kemiri serta implementasi pada pembelajaran kimia pokok bahasan minyak bumi laju konsumsi pertumbuhan kura kura batok cuora amboinensis yang diberi pakan kangkung darat ipomoea reptans usus ayam pengaruh kompensasi disiplin kerja lingkungan kerja terhadap prestasi kerja karyawan pada pt karya citra tanindang bengkulu analisis vegetasi hutan dataran rendah lokasi hutan produksi terbatas desa apohoo pulau enggano pengaruh pemberian ekstraks daun tembakau nicotiana tabacum l terhadap perkembangan tulang tengkorak tulang belakang tulang rusuk embrio mencit mus musculus pergantian posisi pe garang proses kejiwaan novel lubang dari separuh langit karya afrizal malna analisis tokoh utama novel sihir cinta karya miranda penyebaran kura kura berdasarkan habitat sungai rawa hutan suaka alam pasar ngalam air periukan kabupaten seluma persepsi siswa kelas xi mengenai pelaksanaan proses belajar mengajar guru bidang bahasa sastra indonesia sma negeri 7 kota bengkulu tahun ajaran 2006 2007 communication fillers used by the english department students of fkip bengkulu university in language teaching seminar presentation analisis struktur fisik struktur batin puisi pada tabloid gaul analisis inventory control kondisi ketidakpastian demand lead time kasus perum percetakan negara ri cabang bengkulu upaya meningkatkan proses hasil belajar fisika siswa melalui pendekatan kontekstual dengan metode inkuiri 1 pada konsep gelombang optik kelas x semester dua sma negeri 1 lais bengkulu utara classroom action research hidrolisis minyak sawit mentah cpo dengan katalis asam klorida h zeolit penerapan teori belajar mengajar gal perin sebagai upaya peningkatan kemampuan pemecahan soal fisika siswa kelas x sma negeri 6 bengkulu classroom action research inventarisasi jenis jenis jamur makroskopis dikampus universitas bengkulu jl raya kandang limun bengkulu sebagai media pembelajaran biologi sma pada pokok bahasan fungi jamur peranan panti sosial bina remaja harapan bengkulu membina remaja putus sekolah terlantar analisis soal bahasa indonesia berdasarkan kurikulum berbasis kompetensi kbk semester genap pada kelas x man 2 curup tahun ajaran 2005 2006 pengaruh promosi politik terhadap respon pemilih pasangan gubernur wakil gubernur bengkulu periode 2005 2010 kasus pada mahasiswa jurusan manajemen fakultas ekonomi universitas bengkulu komunitas fitoplankton air lindi leachate tpa sampah air sebakul kota bengkulu pertunjukan mainangan pada masyarakat bintuhan isolasi minyak dari daging buah alpukat persea americana mill analisis pengaruh perubahan konsentrasi naoh terhadap asam lemak serta uji sifat fisik metil ester hasil transesterifikasi avocado oil pertumbuhan semai jati putih gmelina arborea roxb dengan beberapa taraf pemberian tsp vermikompos pada media subsoil ultisol bengkulu error analysis in application letter written by the second year students of vocational high school of smkn i bengkulu in academic year 2006 2007 penerapan pendekatan kontekstual pembelajaran kimia sebagai upaya peningkatan aktivitas hasil belajar siswa kelas xi ipa sma negeri 1 ketahun bengkulu utara classroom action research english learning styles in learning activities preferred by the second grade students of smkn 4 bengkulu pengaruh kegagalan jasa service failure terhadap perilaku berpindah switching behavior kesetiaan pelanggan customer loyalty pada industri jasa pengaruh economic value added eva terhadap return saham industri manufaktur yang listed bursa efek jakarta variasi morfologi bagian karapaks plastron pada beberapa jenis kura kura bengkulu pemberian rasio kubis putih brassica oleracea rucah ayam sebagai pakan serta pengaruhnya terhadap pertumbuhan kura kura garis hitam cyclemys oldhamii tenses mastery of the fourth semester students of english study program universitas bengkulu 2005 2006 academic year upaya meningkatkan hasil belajar kimia siswa kelas xi ipa 1 sman 8 kota bengkulu melalui penerapan model pembelajaran kooperatif tipe think pair share menggunakan metode sscs a communicative tasks analysis of english material used at the nursing department of poltekkes bengkulu in curup the rule of current communication between a pilot and an air traffic controller before landing and taking off at fatmawati soekarno airport persepsi siswa mengenai penggunaan buku teks bahasa indonesia kelas v sd negeri 22 kota bengkulu tahun ajaran 2006 2007 analisis teka teki masyarakat rejang pesisir desa durian daun kecamatan lais kabupaten bengkulu utara pengaruh lama penyimpanan level larutan temulawak curcuma xanthoriza roxb terhadap jumlah jenis mikroba pada tabut block aspek penalaran aspek kebahasaan tulisan siswa kelas viii smp n i lebong utara analisis deskriptif pola pengeluaran konsumsi rumah tangga karyawan pemanen pt agri andalas pada karyawan pemanen perumahan pt agri andalas desa pasar ngalam kec air periukan kab seluma strategi pemasaran meningkatkan volume penjualan pada rumah makan semalam suntuk bengkulu anatomi organ reproduksi kura kura garis hitam cyclemys oldhamii kura kura patah dada cuora amboinensis departemen pendidikan nasional sebaran kura kura air tawar kura kura teresterial kabupaten bengkulu utara analisis faktor faktor yang mempengaruhi permintaan jasa titipan kilat pt posindo propinsi bengkulu analisis deskriptif buku lks fisika smp kelas i kota bengkulu kajian terhadap kaidah penulisan naskah naskah ulu seluma etnobotani tumbuhan obat tradisional suku batak toba desa sinaga uruk pandiangan kecamatan nainggolan kabupaten samosir propinsi sumatera utara analisis struktur makna pantun pada masyarakat pekal konversi karakterisasi metil ester dari limbah cair industri pengolahan cpo crude palm oil serta implementasinya pada mata pelajaran kimia sma kelas x pokok bahasan minyak bumi distribusi kelimpahan ikan daerah pasang surut sungai ketahun kecamatan ketahun kabupaten bengkulu utara analisis keberhasilan kepemimpinan pengelolaan kegiatan madrasah diniyah awaliyah mda al quraniyah kota manna sebaran kura kura air tawar kura kura terrestrial kabupaten kepahiang bengkulu analisis kualitas pelayanan hubungannya dengan kepuasan konsumen pada pt panorama sarana trvel pt aryo tour travel cv sam travel bengkulu evaluasi pelaksanaan panduan pengembangan sosial emosional anak usia dini kasus paud sedasen jl a yani no 2a kecamatan curup kabupaten rejang lebong pemberdayaan anak jalanan melalui program pendidikan luar sekolah yang diselenggarakan oleh dinas pendidikan nasional kota bengkulu kasus anak jalanan kawasan jalan soeprapto kota bengkulu pengaruh pelatihan pengembangan terhadap kepuasan kerja pegawai bagian medis perawatan rumah sakit umum daerah rsud dr m yunus bengkulu upaya meningkatkan hasil belajar konsep dinamika rotasi dengan pendekatan permasalahan terbuka open ended problem kelas xi ipa sma negeri 5 kota bengkulu tahun ajaran 2006 2007 3 classroom action ressearch pelibatan warga belajar pembelajaran pada program paket b setara sltp pkbm melati rawa makmur permai kota bengkulu penerapan metode pembelajaran sq3r survey question read recite review secara kooperatif upaya peningkatan aktivitas hasil belajar kimia siswa kelas xf sma negeri 6 kota bengkulu classroom action research pola asuh anak balita ibu tani pekerja sawah kasus kelurahan pematang gubernur kecamatan muara bangkahulu kota bengkulu analisis perbandingan pertumbuhan ekonomi kota bengkulu kota lubuklinggau periode 1995 2004 isolasi senyawa steroid dari akar gaharu aquilaria malaccensis uji pengaruhnya sebagai antidepresi pada mencit mus musculus jantan peningkatan keterampilan berbicara dengan menggunakan model jigsaw kelas x 2 sma negeri 8 kota bengkulu tahun ajaran 2006 2007 penelitian tindakan kelas upaya meningkatkan aktivitas hasil belajar kimia siswa dengan menerapkan metode pemberian tugas problem posing melalui diskusi kelompok classroom action research keterampilan mengajar mahasiswa program pendidikan kimia pada mata kuliah ppl 1 upaya meningkatkan proses hasil belajar siswa melalui metode kooperatif tipe tgt team games tournamen konsep usaha energi pada siswa kelas viia smp negeri 2 kota bengkulu classroom action research isolasi senyawa alkaloid total dari akar pasak bumi eurycoma longifolia jack uji pengaruhnya terhadap perilaku seksual konsentrasi spermatozoa mencit us musculus serta implementasinya pada mata kuliah kimia organik bahan alam karakteristik kemiskinan masyarakat kelurahan bentiring beringin raya kecamatan muara bangka hulu kota bengkulu pengembangan media pembelajaran kimia dengan memanfaatkan program microsoft powerpoint macromedia flash pada pokok bahasan kimia karbon sebagai upaya meningkatkan efektivitas belajar kimia kelas x sma negeri 6 kota bengkulu a survey on the roles of parent in motivating supervising and guiding their children to improve their learning results in english a study at smpn 1 bengkulu analisis perkembangan ekspor impor migas indonesia periode 1990 2004 kecenderungan tema puisi karya siswa smp negeri kota bengkulu majalah dinding tahun 2005 2007 analisis variabel variabel yang mempengaruhi dividend payout ratio pengujian periode sebelum selama krisis ekonomi pada perusahaan perusahaan non keuangan yang terdaftar bursa efek jakarta analisis perkembangan usaha kecil menengah kota bengkulu periode 1995 2005 the students strategies to manage anxiety in english class a study at the second year students of sman 1 bengkulu town in academic year 2006 2007 identifikasi keanekaragaman jenis tumbuhan sma negeri i kerkap sebagai media pembelajaran biologi pada kelas x upaya peningkatan proses pembelajaran kimia siswa kelas x sma negeri 8 kota bengkulu tahun ajaran 2006 2007 melalui model problem based instruction pbi dengan metode diskusi 3 classroom action research analisis sosiologi sastra novel lelaki terindah karya andrei aksana pembelajaran dengan pendekatan problem possing metode diskusi kelompok meningkatkan prestasi belajar konsep listrik dinamis kelas xe sma negeri 6 kota bengkulu penelitian tindakan kelas analisis kepuasan konsumen terhadap jasa kursus komputer bina sarana informatika bengkulu keanekaragaman jenis pohon kampus universitas bengkulu jl raya kandang limun bengkulu sebagai media pembelajaran biologi sma pada pokok bahasan keanekaragaman hayati bagaimana pengaruh pendapatan harga kelompok referensi terhadap keputusan pembelian polis asuransi jiwa pada ajb bumiputera 1912 curup aplikasi quality function deployment qfd pada hotel putera bengkulu penerapan model pembelajaran siklus belajar 5e meningkatkan hasil belajar ipa biologi siswa kelas viiie smpn 11 kota bengkulu problematik guru melaksanakan penilaian menggunakan kurikulum berbasis kompetensi kbk mata pelajaran bahasa sastra indonesia sman 3 bengkulu penggunaan hand out pada pembelajaran fisika konsep alat alat optik kelas viii smp terbuka selebar kota bengkulu penelitian tindakan kelas identifikasi soal ujian blok mata pelajaran biologi kelas vii smp negeri i kota bengkulu tahun ajaran 2006 2007 pada aspek kemampuan kognitif faktor yang melatar belakangi anak bekerja sektor informal upaya pemberdayaan anak kasus dikawasan jln yos sudarso kota lubuk linggau sumatera selatan perbedaan kemampuan belajar antara siswa kelas akselerasi dengan siswa kelas reguler smp negeri 1 kota bengkulu pelajaran fisika analisis keunikan history heritage natural tourism sektor pariwisata kota bengkulu ditinjau dari persepsi konsumen serta implikasinya pada strategi pemasaran faktor faktor yang mempengaruhi earnings response coefficient erc pada perusahaan bertumbuh tidak bertumbuh nilai nilai religius pada kumpulan cerpen ketika mas gagah pergi karya helvy tiana rosa inventarisasi jenis jenis ikan hias perairan pulau tikus bengkulu pembuatan keju dengan protease mucor sp implementasinya pada pembelajaran pengantar bioteknologi program pendidikan kimia fkip unib upaya meningkatkan hasil belajar kimia siswa kelas xi ipa 3 sma negeri 4 kota bengkulu pada pokok bahasan termokimia melalui penerapan pembelajaran kooperatif tipe teams assisted individualization tai model pembelajaran kooperatif tipe tai teams accelerated instruction meningkatkan hasil belajar aktivitas siswa pada konsep suhu kalor kelas xb sma n 2 kota bengkulu classroom action ressearch pelaksanaan program pelatihan tahun 2006 balai latihan kerja blk manna meningkatkan keterampilan peserta pelatihan komputer upaya meningkatkan hasil belajar fisika dengan model pembelajaran kooperatif cooperative learning seri numbered heads together pada konsep suhu kalor kelas x 1 sma negeri 1 talang empat classroom action research evaluasi kinerja panen pada perkebunan teh ptpn vi kayu aro kerinci jambi komposisi spesies morfometrik ikan kerapu serranidae yang daratkan kabupaten kaur upaya peningkatan hasil belajar fisika pada konsep usaha energi melalui media komputer kelas vii smpn 3 kota bengkulu classroom action ressearch hubungan minat belajar matematika dengan sikap belajar matematika pada siswa kelas viii smp n 7 kota bengkulu penerapan prinsip prinsip belajar orang dewasa pada kegiatan pembelajaran keterampilan deskriptif lembaga pemasyarakatan kelas ii a bengkulu strategi pengajaran puisi kelas vc sekolah dasar negeri 69 kota bengkulu tahun ajaran 2006 2007 analisa pendapatan efisiensi usahaternak ayam buras telaah terhadap dua pola pemeliharaan intensif semi intensif kota bengkulu pengaruh gaya kepemimpinan demokratis pemberian insentif terhadap disiplin kerja pegawai pada kantor pelayanan perbendaharaan negara bengkulu pelaksanaan sita jaminan terhadap harta bersama pengadilan agama bengkulu profil guru model pada penerapan lesson study matematika smpn 15 smpn 11 kota bengkulu pertumbuhan bibit lamtoro dengan pemanfaatan rhizobium cma lahan pasca tambang batubara kajian faktor faktor penyebab rendahnya kualitas inti sawit berdasarkan kadar inti sawit pecah kadar kotoran inti sawit kadar air inti sawit ptpn vii talo pino bengkulu analisis break even point perencanaan laba pada pabrik es balok jakarta kota bengkulu penerapan pembelajaran ipa fisika berbasis pendekatan keterampilan proses pkp dengan metode inkuiri meningkatkan pengetahuan prosedural siswa kelas vii3 smpn 1 bengkulu classroom action research laju dekomposisi seresah daun rhizophora apiculata bl avicennia alba bl kawasan hutan mangrove desa kandang kota bengkulu performans pertumbuhan ayam burgo ayam kampung hasil persilangannya penggunaan tepung daun sukun artocarpus communis meningkatkan kualitas karkas pada ayam broiler aplikasi eceng gondok em 4 terhadap pertumbuhan hasil padi gogo pada lahan bekas alang alang faktor faktor yang mempengaruhi upah minimum propinsi bengkulu pengaruh rasio substrat air asam tambang terhadap ragam populasi jasad renik pada waktu inkubasi yang berbeda analisis faktor faktor yang mempengaruhi kualitas produk barang jasa rumah makan kasus rumah makan sate solo bengkulu pengaruh peramalan price earning ration per ukuran perusahaan size market book value mbv terhadap abnormal return saham bursa efek jakarta bahan organik respirasi tanah dbawah lima tipe tegakan hutan das musi analisis model persediaan inventory obat obatan pada pt kimia farma td bengkulu pengaruh iklim organisasi gaya kepempimpinan lingkungan kerja terhadap kinerja karyawan pada kejaksaan negeri bengkulu pengaruh strategi inovasi terhadap struktur modal perusahaan pada industri manufaktur indonesia analisis faktor faktor yang mempengaruhi permintaan ikan laut propinsi bengkulu analisis pelaksanaan program kerja kelompok citra perempuan jayakarta kasus pada kelompok citra perempuan jayakarta desa jayakarta kecamatan talang empat kabupaten bengkulu utara kohesi koherensi kolom ibrah majalah hidayatullah edisi januari desember 2005 pemberdayaan hukum lokal pengelolaan wilayah pesisir laut daerah supremasi hukum 12 2 81 91 1693 766x analisis perubahan penyerapan tenaga kerja sub sektor perkebunan propinsi bengkulu pengaruh complain handling service guarantee terhadap loyalitas pelanggan kasus dealer kangaroo motor bengkulu effect fermented palm kernel cage portion in feed of ikan mas cyprinus carpio l jipi 9 1 71 76 1411 0067 hubungan antara struktur modal tipe kepemilikan dengan kelengkapan pengungkapan laporan keuangan perusahaan perbankan yang listed bursa efek jakarta 1 efikasi ekstrak babandotan ageratum conyzoides l terhadap crocidolomia binotalis zeller pemanfaatan rhizobium cma terhadap aktivitas jasad renik pada pertumbuhan hasil tiga kultivar kedelai ultisols inventarisasi tumbuhan yang dimanfaatkan masyarakat desa tanjung terdana dari taman hutan raya tahura rajo lelo sekitarnya kecamatan pondok kelapa kabupaten bengkulu utara provinsi bengkulu pengaruh ukuran perusahaan risiko perusahaan profitabilitas jenis industri terhadap status perataan laba income smoothing pada perusahaan yang terdaftar bursa efek jakarta bej analisis pendapatan efisiensi biaya usaha perkebunan kelapa sawit rakyat desa riak siabun kecamatan sukaraja kabupaten seluma analisis komoditas unggulan sektor pertanian kabupaten mukomuko pengaruh pemberian pupuk bio cair pupuk kotoran ayam terhadap n total serapan n hasil tanaman jagung pada ultisol analisis weekend effect terhadap imbal hasil saham bursa efek jakarta kasus tahun 2001 2003 students perception toward english teaching techniques used by english teachers in sman 5 bengkulu efek instabilitas nilai tukar rupiah terhadap penawaran ekspor kopi indonesia harga kopi domestik analisis permintaan integrasi pasar ekspor kopi indonesia pengaruh strategi inovasi profitabilitas serta nteraksinya tehadap struktur modal perusahaan pada industri anufaktur indonesia analisis tingkat kepercayaan nelayan terhadap analisis tingkat kepercayaan nelayan terhadap keberhasilan programkeberhasilan program program pemberdayaan program pemberdayaan dari pemerintah kota bengkuludari pemerintah kota bengkulu kasus pada nelayan kelurahan malabero kecamatan teluk segara peranan value for money audit menunjang efektivitas pengadaan barangdi pemerintah daearah kasus dinas pendapatan daerah provinsi bengkulu peningkatan n total ph hasil tanaman padi gogo melalui pemberian pupuk n pupuk kandang sapi tithonia diversifolia pada ultisol identifikasi faktor faktor yang mendukung keberhasilan mahasiswa fisika program pengalaman lapangan pplii pada tahun 2006 pengujian kandungan informasi pengumuman merger akuisisi terhadap abnormal return saham perusahaan akuisitor bursa efek jakarta pengaruh kebudayaan kelas sosial kelompok referensi terhadap pengambilan keputusan pembelian kaset musik perubahan serapan n p pada tiga kultivar kedelai sebagai akibat pemberian pupuk hayati rhizobium cma ultisols sandiwara senayan dramaturgis komunikasi politik dpr ri in metode penelitian komunikasi remaja rosdakarya bandung 25 78 979 692 81& analisis sistem administrasi puskesmas mmberikan pelayanan kesehatan ibu anak kia kasus pada puskesmas sukamerindu kota bengkulu hubungan kepemimpinan transformasional komunikasi dengan sikap terhadap perubahan kasus pada kantor arsip daerah kota bengkulu pengaruh keikutsertaan menjadi akseptor kb terhadap tingkat kesejahteraan keluarga kasus pada masyarakat kelurahan panorama kecamatan gading cempaka kota bengkulu penerapan pendekatan kontekstual dengan model kooperatif tipe student team achievement division stad meningkatkan hasil belajar siswa pada pokok bahasan tekanan kelas vii e smp negeri 6 bengkulu classroom action research kajian pola pertumbuhan kacang bogor pada berbagai dosis waktu pemupukan nitrogen analisis kinerja pegawai sub bagian umum pada dinas kimpraswil manna kabupaten bengkulu selatan upaya meningkatkan prestasi belajar siswa kelas x3 sma n 7 kota bengkulu pembelajaran biologi menggunakan metode discovery inquiry pengaruh faktor demografi computer anxiety terhadap keahlian dosen akuntansi menggunakan komputer efektivitas ekstrak daun kelopak bunga sirsak annona muricata l terhadap ulat jantung kubis crocidolomia binotalis zeller faktor faktor yang menyebabkan gizi buruk pada balita kasus pada balita penderita gizi buruk wilayah kerja puskesmas lubuk durian bengkulu utara analisa faktor faktor yang berhubungan dengan tingkat penunggakan pengembalian kredit p4k proyek peningkatan pendapatan petani nelayan kecil kecamatan muara bangkahulu kota bengkulu produksi rumput tebu salah phragmites sp sebagai sumber hijauan pakan potensial pada berbagai umur pemotongan analisis implementasi perencanaan pembangunan pasca pemekaran kecamatan kota bengkulu pada kecamatan teluk segara kecamatan sungai serut evaluasi pembinaan keterampilan kerja bagi narapidana pada lembaga pemasyarakatan kasus rumah tahanan negara kelas ii b manna kabupaten bengkulu selatan pengaruh kompensasi pelatihan terhadap kinerja karyawan pt pln persero wilayah s2jb cabang bengkulu analisis efisiensi produksi kopi desa betungan kecamatan kedurang kabupaten bengkulu selatan efektivitas cendawan trichoderma sp gliocladium sp pengendalian fusarium oxysporum schlecht ex fr penyebab penyakit layu pada tanaman krisan analisis penerapan teori antrian upaya meningkatkan pelayanan konsumen pada pt bank central asia tbk cabang bengkulu kasus pada bagian teller pengaruh jarak tanam dosis pupuk p terhadap pertumbuhan produksi bahan kering bahan organik protein kasar pada tanaman indigofera indigofera arrecta efektivitas pelaksanaan tugas petugas pajak bumi bangunan pbb wilayah kerja kelurahan rawa makmur kota bengkulu hubungan antara sifat keasaman luas permukaan spesifik volume pori rerata jejari pori katalis terhadap aktivitasnya pada reaksi hidrogenasi cis isoeugenol exacta 5 1 24 30 1412 3617 analisis efisiensi usaha tani wortel daucus carotal faktor faktor sosial ekonomi yang mempengaruhi pendapatan kasus desa suban ayam kecamatan selupu rejang kabupaten rejang lebong analisis beta pada pasar yang sedang bullish bearish empiris bursa efek jakarta paya meningkatkan proses hasil belajar fisika dengan pendekatan accelerated learning melalui penerapan langkah kerja master pada konsep alat optik kelas viii smp negeri 6 kota bengkulu a classroom action research analisis efektivitas kerja pegawai bagian tata usaha pada kantor wilayah departemen agama provinsi bengkulu pengaruh perlakuan skarifikasi konsentrasi asam gibberellin ga terhadap perkecambahan benih aren arenga pinnata merr pengaruh pengembangan karir kepempimpinan kemampuan terhadap motivasi kerja karyawan pt persero pelabuhan indonesia ii cabang bengkulu perbandingan daya kecambah antara cabai keriting capsicum annuum l var longum cabai hasil grafting keriting capsicum annuum l var longum dengan rawit capsicum frustescens pada berbagai media tanam penerapan pendekatan kontekstual dengan model pembelajaran kooperatif meningkatkan hasil belajar biologi siswa kelas viii d smp negeri 15 kota bengkulu penelitian tindakan kelas pengaruh hukum adat terhadap putusan hakim perkara warisan pengadilan negeri arga makmur analisis curahan waktu tenaga kerja pada cabang usahatani padi desa rimbo recap kecamatan curup kabupaten rejang lebong penyelesaian pengembalian pembiayaan bermasalah pt sarana bengkulu ventura the use of humic acid in arbuscular mycorrhizal fungi of high salinity ecosystem jipi 9 2 124 129 1411 0067 pemanfaatan enzim bromelin proses pembuatan minyak kelapa sebagai awal usaha rumah tangga dharma raflesia 5 2 74 80 1693 8048 pengaruh pengapuran pupuk kandang terhadap n total tanah serapan n serta pertumbuhan semai lamtoro pada media tanah bekas penambangan batubara analisis permintaan telepon selular kota bengkulu the efforts of renewing and absorbing of metal on used cooking oil from traditional food industries through application of bioadsorbent of empty fruit bunch of palm jipi 9 2 85 93 1411 0067 pengaruh komposisi genetik puyuh coturnix coturnix japonica hasil persilangan asal tiga daerah terhadap performans karkas puyuh betina afkir efektivitas komunikasi pembangunan pasca pemekaran wilayah kota bengkulu tentang jaring aspirasi masyarakat kota bengkulu analisis butir soal ujian blok 1 kimia kelas x sman 4 kota bengkulu tahun pelajaran 2006 2007 kausalitas keputusan investasi pembiayaan kebijakan dividen pada perusahaan manufaktur yang terdaftar bursa efek jakarta analisis faktor faktor yang mempengaruhi permintaan jasa transportasi darat mikrolet yang beroperasi dari kecamatan kaur utara ke terminal gunung ayu evaluasi hasil pembelajaran warga belajar program keaksaran fungsional angkatan 1 tahun 2006 2007 pada sanggar kegiatan belajar kabupaten seluma berdasarkan acuan evaluasi pembelajaran program keaksaran fungsional oleh direktorat pendidikan masyarakat tahun 2005 kajian manajemen warga belajar tutor kurikulum sarana prasarana program keaksaraan fungsional binaan pkbm tunas agung desa paku haji kecamatan pondok kelapa kabupaten bengkulu utara pengaruh substitusi konsentrat daun kering kaliandra calliandra calothyrsus terhadap jumlah produksi 4% fcm lemak bahan kering bahan kering tanpa lemak protein laktosa susu sapi perah fries holland potention of three genera of bacteria from three of crop rhizosphere as biological control agent of the lincat disease jipi 9 1 40 47 1411 0067 pengaruh persepsi konsumen atas sumber pesan terhadap keputusan pembelian iklan tv produk motor yamaha kota bengkulu tingkat adopsi konsumen berdasarkan karakteristik produk baru inovasi pada telepon selular potensi beberapa isolat cma mengimbas ketahanan bibit akasia acacia mangium willd terhadap jamur akar putih pengaruh pendidikan pengalaman kerja karyawan terhadap promosi jabatan kasus pada pt bank rakyat indonesia persero cabang argamakmur comparison of heart rate and factorial method measurements for predicting energy expenditure in working lactating ewes jipi 9 2 148 155 1411 0067 the effects of melunyah on physiological parameters of swamp buffalo in bengkulu selatan district bengkulu province pengaruh pengencer kuning telur dengan air kelapa lama penyimpanan terhadap kualitas semen kambing nubian penerapan quality function deployment qfd peningkatan kinerja industri kecil bakso sapi berdasarkan kepuasan pelanggan information search process meminimalisasikan perseives risk berdasarkan klasifikasi jasa perbandingan komponen kimia kayu acacia auriculiformis a cunn acacia mangium willd sebagai bahan baku pulp kertas pengujian terhadap keterkaitan antara kebijakan dividen kebijakan hutang secar simultan kasus pada perusahaan manufaktur yang terdaftar bej identifikasi karakteristik sosial ekonomi masyarakat nelayan kota bengkulu kasus wilayah pasar bengkulu pasar pantai kandang teluk sepang penggunaan tepung jagung pada pembuatan sala lauak over reaksi pasar pengaruh ukuran perusahaan terhadap pembalikan harga saham perusahaan manufaktur yang terdaftar bursa efek jakarta analisis faktor yang mempengaruhi pendapatan usaha penggilingan kopi kecamatan bermani ilir kabupaten kepahiang role of seed size in re sprouting ability of oak seedling after being damaged by herbivory jipi 9 2 156 164 1411 0067 pengaruh pemberian pakan kroto sarang walet terhadap daya hidup anak burung walet putih collocalia fuciphaga hasil penetasan tingkat kesukaan terhadap jenis seresah kecepatan dekomposisi seresah tanaman kehutanan oleh cacing tanah pontoscolex corethrurus identifikasi faktor penentu rawan longsor kasus kawasan jalan utama yang menghubungkan bengkulu curup kajian pendahuluan populasi siamang hylobates syndactylus raffles bukit lumut hutan lindung gedang hulu lais kabupaten lebong analisis faktor faktor yang mempengaruhi keputusan konsumen berlangganan kartuhalo pada pt telkomsel bengkulu analisis faktor faktor yang berhubungan dengan alih fungsi lahan dari usahatani jeruk manis ke usahatani kelapa sawit nagari ujung gading kecamatan lembah melintang kabupaten pasaman barat propinsi sumatera barat pertumbuhan hasil jahe merah muda bawah tegakan karet pada berbagai dosis nitrogen posfor isolasi senyawa diosgenin dari umbi gadung d iosc ore a hi spi da uji pengaruhnya terhadap konsentrasi serta abnormalitas spermatozoa mencit m us mu s cu lu s pengaruh komposisi genetik hasil persilangan puyuh coturnix coturnix japonica tiga daerah asal bengkulu padang yogyakarta terhadap performans reproduksi deskripsi budaya organisasi kinerja karyawan pt bank muamalat indonesia tbk cabang bengkulu analisis kualitas pelayanan publik pasca pemekaran kecamatan pada kecamatan gading cempaka kota bengkulu kontribusi pendapatan bunga kpr kredit pemilikan rumah terhadap total pendapatan pada pt bank tabungan negara persero cabang bengkulu pengaruh rubrik seks majalah citacinta terhadap perilaku seksual bebas dikalangan mahasiswa deskriptif mengenai pengaruh rubrik seks majalah citacinta terhadap perilaku seksual bebas dikalangan mahasiswa fakultas ilmu sosial ilmu politik universitas bengkulu partisipasi masyarakat perencanaan program penanggulangan kemiskinan perkotaan p2kp iii berbasis community development kasus desa lunjuk kec seluma barat kab seluma pemanfaatan kapur pupuk mikrob perbaikan beberapa sifat biologi tanah hasil kedelai pada ultisol bengkulu pelaksanaan otonomi desa pada wilayah transmigrasi kecamatan pondok kelapa kabupaten bengkulu utara ditinjau dari undang undang nomor 32 tahun 2004 analisis variabel struktur modal return on asset terhadap rentabilitas modal sendiri pada perusahaan rokok go public kasus bursa efek jakarta analisis output program unit pengelolaan keuangan desa bengkulu regional development project upkd brdp bidang pertanian kajian sosial ekonomi masyarakat miskin desa sumberejo transad kecbermani ulu kabrejang lebong pelaksanaan perjanjian pengadaan kartu mahasiswa antara pt bni persero tbk dengan universitas bengkulu interaksi belajar mengajar pembelajaran puisi siswa kelas viii sltp negeri 18 kota bengkulu perkawinan bawah tangan perspektif uu nomor 1 tahun 1974 kecamatan ratu samban kota bengkulu pengaruh struktur imbalan kepemimpinan terhadap komitmen karyawan non medis rsud dr m yunus bengkulu multipikasi tunas mikro panili vanilla planifolia andrews pada beberapa taraf konsentrasi amonium nitrat sukrosa patogenesitas cendawan metarrhizium anisopliae metch sorokin pada spodoptera litura f lepidoptera noctuidae perbandingan kualitas pulp batang campuran batang dengan cabang kayu mangium acacia mangium willd pada berbagai konsentrasi alkali aktif substitusi nitrogen anorganik dengan bahan organik dari gulma wedelia trilobata pada sawi analisis pendapatan pemasaran usaha pembesaran ikan nila oreochromis niloticus desa tanjung harapan kecamatan padang jaya kabupaten bengkulu utara analisis perbedaan usaha mikro sebelum sesudah menerima pembiayaan kota bengkulu kasus kantor pelayanan kas bprs muamalat harkat kota bengkulu karakteristik lengas tanah pada beberapa tanah ordo entisol modifikasinya melalui pemberian pupuk kandang pengaruh penggunaan minyak ikan lemuru sardinella longiceps niasin terhadap performans kambing lokal jantan pengaruh perilaku berpindah switching behavior terhadap kepercayaan merek brand trust kesetiaan pelanggan customer loyalty pada jasa hospitality pada jasa restoran rumah makan hotel rental video kualitas pelayanan publik pada unit pelaksana teknis dinas balai pengujian kendaraan bermotor kota bengkulu pengaruh motivasi kualitas motivasi ekonomi motivasi karir terhadap minat mahasiswa peserta pendidikan profesi akuntansi ppak analisis kinerja keuangan tingkat pengembalian kredit agribisnis pada koperasi simpan pinjam citra baru analisis nilai tambah pemasaran susu sapi pada usaha sapi perah kecamatan selupu rejang kabupaten rejang lebong pengaruh dosis waktu pemupukan nitrogen terhadap pertumbuhan hasil kacang bogor analisis pendapatan pengusaha jual beli motor bekas kota bengkulu pengaruh konsep diri dengan perilaku komunikasi antarpribadi pada remaja akhir pada mahasiswa komunikasi fisip unib peranan pupuk bio cair pupuk kandang kotoran ayam terhadap ketersediaan p serapan p hasil tanaman jagung pada ultisols hubungan corporate governance kinerja perusahaan kualitas laba pelaksanaan perjanjian kerjasama pembiayaan konsumen antara pt federal international finance fif dengan ud matahari furniture kota bengkulu analisis sikap perilaku petani terhadap dua benih jagung hibrida dekalb c7 pioneer p12 desa sukasari kecamatan air periukan kabupaten seluma efektivitas penatausahaan perlengkapan laboratorium pada fakultas matematika ilmu pengetahuan alam universitas bengkulu pengaruh pesan persuasif bidan terhadap motivasi pus mengikuti kb pada puskesmas bentiring kecamatan pondok kelapa kabupaten bengkulu utara pencatatan kekuatan hukum akta kelahiran bagi anak luar nikah pada prakteknya kota bengkulu analisis faktor faktor yang mempengaruhi konsumen terhadap permintaan babi bali desa rama agung kecamatan arga makmur kabupaten bengkulu utara kasus analisis pendapatan usahatani padi sistem sakap non sakap faktor faktor yang mempengaruhi produksinya kasus desa batu roto desa alun dua kecamatan kerkap bengkulu utara kinerja tutor program paket b setara sltp kabupaten rejang lebong analisis kompetensi kepribadian guru kimia lulusan fkip universitas bengkulu yang mengajar sma negeri kota bengkulu analisis permintaan gas elpiji sektor rumah tangga kota bengkulu peranan manajemen keselamatan kesehatan kerja kinerja karyawan pada pt batanghari bengkulu pratama bengkulu utara pengaruh pemberian beberapa jenis umbi umbian terhadap pertumbuhan jangkrik gryllus mitratus umur 10 50 hari analisis tema berita politik pada harian kompas suatu riset analisis isi kuantitatif berdasarkan tema tema berita pada rubrik politik harian kompas edisi 1 31 januari 2007 pengaruh kombinasi pupuk organik salvinia molesta pupuk nitrogen anorganik terhadap pertumbuhan hasil sawi pengaruh kedalaman drainase terhadap pertumbuhan beberapa jenis anakan pisang jantan pada lahan gambut analisis implementasi program bantuan operasional sekolah bos pembebasan biaya pendidikan bagi siswa kasus sd negeri 69 kandang limun kota bengkulu analisis vegetasi hutan wisataway hawang kecamatan maje kabupaten kaur analisis hubungan promosi jabatan dengan motivasi kerja karyawan kasus pada kantor bank rakyat indonesia rejang lebong dampak pupuk hayati pada serapan hara nitrogen fosfor biomassa kedelai varietas pangrango analisis faktor penyebab timbulnya perilaku seks pranikah remaja kasus pada remaja yang melakukan seks pranikah kota curup kabupaten rejang lebong analisis kegiatan pembelajaran pada program pertanian hortikultura kasus sekolah rakyat alternatif sra desa sumber urip kec selupu rejang kab rejang lebong analisis kualitas produk jasa instalasi rawat inap rumah sakit tk iv 020701 detasemen kesehatan tentara bengkulu analisis sikap perilaku konsumen terhadap makanan manisan terong irt nur kota bengkulu peranan unit pelayanan fungsional upf rehabilitasi memperbaiki keberfungsian sosial pasien gangguan mental jiwa yang dirawat inap analisis curahan waktu tenaga kerja wanita pada usaha ternak sapi perah kontribusinya terhadap pendapatan keluarga kecamatan selupu rejang kabupaten rejang lebong efektivitas pemberian pupuk npk terhadap pertumbuhan gaharu aquilaria malaccensis lamk pada tanah podsolik merah kuning lahan stasiun percobaan universitas bengkulu konsep merger perseroan terbatas menurut perspektif hukum islam pengujian beberapa konsentrasi ekstrak daun sirih piper batle l menekan infeksi jamur patogen tular benih kacang tanah arachis hypogaea l penerapan model pembelajaran kooperatif tipe think pair share sebagai upaya meningkatkan hasil belajar kimia siswa kelas xi ipa c sman 6 kota bengkulu pokok bahasan stuktur atom sistem periodik identifikasi potensi komoditi jahe gajah zingiber officinal rose kecamatan muara sahung pengembangannya kabupaten kaur pengajaran remedial pada pokok bahasan pecahan siswa kelas v sd negeri kota bengkulu penelitian tindakan kelas analisis perilaku menabung masyarakat nelayan kota bengkulu kasus pasar bengkulu pasar pantai teluk sepang kandang pertumbuhan bibit manggis pada beberapa jenis konsentrasi pupuk daun strategi penanggulangan wabah flu burung oleh dinas peternakan kesehatan hewan kasus dinas peternakan kesehatan hewan propinsi bengkulu pengawasan mutu produk pakaian pada charles taylor bengkulu efektivitas pengelolaan arsip pada kantor arsip daerah arda propinsi bengkulu pengaruh disiplin kerja lingkungan kerja terhadap prestasi kerja karyawan analisis faktor faktor yang mempengaruhi keputusan konsumen memilih apotek paten farma sebagai tempat membeli obat persepsi mahasiswa ilmu komunikasi tentang tayangan republik bbm indosiar analisis kearsipan pada kantor dinas kesejahteran sosial propinsi bengkulu inventarisasi tumbuhan yang dimanfaatkan oleh masyarakat desa babatan kecamatan sukaraja kabupaten seluma propinsi bengkulu tanggapan kepala sekolah terhadap kinerja guru fisika sma negeri swasta kota bengkulu peranan saksi mahkota pembuktian perkara pidana pengadilan negeri bengkulu pengaruh ambiguitas peran konflik peran terhadap kepuasan kerja pegawai pada lembaga pemasyarakatan klas iia bengkulu analisis karakteristik demografi wisatawan ditinjau dari opinion leaders persepsi konsumen mengunjungi objek wisata kota bengkulu pelaksanaan ganti kerugian pelepasan hak milik atas tanah rangka pengadaan tanah pembangunan rumah sakit umum m raba in kabupaten muara enim pengaruh advertorial peserta pilgub bengkulu 2005 harian rb terhadap partisipasi politik pemilih kasus pada pemilih putaran i kelurahan sawah lebar analisis overeducation pada alumni s1 unib yang bekerja kota bengkulu pelestarian hutan damar pangeran balin berbasis hukum adat kecamatan luas kabupaten kaur analisis pengawasan mutu produksi spanduk pada warna advertising kota bengkulu penerapan model investigasi kelompok sebagai upaya meningkatkan hasil belajar matematika kelas vii c mtsn 2 kota bengkulu pengaruh kemiringan lahan kelapa sawit terhadap sedimentasi kasus sub mikro das pada areal perkebunan kelapa sawit belum menghasilkan prosesi adat nundang padi muja padi ditinjau dari hukum islam kasus desa selali kecamatan pino raya kabupaten bengkulu selatan persepsi konsumen terhadap lokasi toko kelengkapan barang harga barang pelayanan sebagai tempat pembelian alat alat motor kasus pada toko palapa motor bengkulu quality test towards semen of nubian goat and its crossing nubian goat x pe and boer goat based on the storage time pengaruh beberapa limbah organik waktu retensi terhadap kualitas air asam tambang acid mine drainage analisis peramalan pasokan bahan baku penjualan karet remah crumb rubber dengan metode arima pt bukit angkasa makmur kembang seri kecamatan talang empat kabupaten bengkulu utara hubungan sifat biologi tanah produksi kelapa sawit pada beberapa vegetasi penutup tanah kasus pt bio nusantara bengkulu utara analisis isi naskah berita tvri bengkulu berdasarkan pasal 36 ayat 1 uu no 32 tahun 2002 tentang penyiaran pengaruh jenis stimulan kelas diameter terhadap produksi getah pinus pinus merkusii jung et de vriese dengan metode riil desa tebat monok kabupaten kepahiang pengaruh pemberdayaan lingkungan kerja terhadap kepuasan kerja komitmen organisasional pada pt federal international finance kantor cabang bengkulu pengaruh suhu terhadap keberhasilan penetasan telur walet putih collocalia fuciphaga dengan menggunakan mesin tetas penerapan pembelajaran kooperatif cooperative learning tipe team games tournament tgt meningkatkan hasil belajar siswa pada pokok bahasan suhu kalor kelas xi smk negeri 2 bengkulu pengaruh kebiasaan membaca novel teenlit terhadap perilaku seksual bebas remaja pengendalian manajemen proyek dengan metode pert program evaluation and review technique pada cv sinar artha gemilang kasus pembangunan proyek irigasi air penyagu kabupaten lebong analisis pola rekrutmen wartawan pada surat kabar harian umum independen bengkulen pos laporan ekspedisi sumatra kalimantan aquatic biodiversity of sundaland documentation sekolah ilmu teknologi hayati itb bengkulu analisis permintaan polis dana primawisuda pada pt asuransi jiwasraya kota bengkulu pertumbuhan agen antagonis pada medium kompos serbuk kayu akasia daya antagonisnya terhadap patogen busuk akar putih peranan penghulu walinagari menyelesaikan sengketa tanah pusako kanagarian situjuah gadang kecamatan situjuah limo nagari kabupaten lima puluh kota faktorfaktorfaktor faktor yang memotivasi wanita faktor yang memotivasi wanita menjadi tenaga kerja tkw menjadi tenaga kerja tkw ke luar negeri kasus tkw kota bengkulu "penerapan sanksi hukum adat setelah diberlakukannya peraturan daerah nomor 29 tahun 2003 tentang pemberlakuan adat kota bengkulu" analisis tingkat efektifitas pelayanan pemerintah kelurahan kasus kelurahan kampung kelawi kecematan sungai serut kota bengkulu analisis pengaruh jumlah uang beredar pdb suku bunga kredit investasi terhadap investasi swasta negeri indonesia periode 1986 2005 kondisi sosial ekonomi petani perambah hutan kawasan taman nasional kerinci seblat kasus kelurahan mubai kecamatan lebong selatan kabupaten lebong pertumbuhan hasil padi gogo dengan pemberian pupuk hijau tithonia pupuk urea pada ultisol pengembangan model penilaian kesesuaian lahan gambut kelapa sawit kasus wilayah irigasi mukomuko kanan suplementasi minyak ikan lemuru sardinella longiceps niasin terhadap kadar kolesterol ldl low density lipoprotein hdl high density lipoprotein serum darah domba lokal efektivitas iklan kartu simpati ekstra melalui media billboard terhadap tingkat pencapaian awareness interest calon konsumen kasus pada pelajar kelas ix unggul smpn 01 kota bengkulu perilaku harga pemasaran ikan laut hasil tangkapan propinsi bengkulu effect of ox hyphophise extract and turmeric flour on local goat productivity structure and birefringence properties of sio2 thiophenes xerogels synthesized by sol gel template malaysia journal of sustainability science and pengaruh pengembangan sdm gaya kepemimpinan motivasi terhadap prestasi kerja karyawan bkpmd provinsi bengkulu penerapan pembuktian terhadap tindak pidana penipuan pengadilan negeri bengkulu analisis kesempatan kerja pada sub sektor industri perbankan propinsi bengkulu kajian terhadap upaya tutor paket c meningkatkan kualitas pembelajaran pkbm dellia kota bengkulu analisa tingkat kepuasan konsumen minuman teh kemasan botol melalui quality function deployment qfd pt coca cola botling indonesia padang analisis produktivitas tenaga kerja buruh perkebunan sawit kabupaten bengkulu utara persepsi anak pada periklanan produk makanan anak televisi hubungannya dengan keputusan pembelian kecamatan sungai serut kota bengkulu perbandingan antara pemberian les dengan sistem tracking pemberian les dengan sistem tradisional sma negeri 1 kerkap bengkulu utara penerapan model pembelajaran kooperatif cooverative learning cl seri numbered head together nht sebagai upaya meningkatkan hasil belajar biologi siswa kelas ix6 smp n 5 kota bengkulu classroom action research students attitude toward command and request used by the english teachers third year of language study class of sman 2 bengkulu town academic year 2006 2007 analisis perilaku mahasiswa memegang uang tunai kasus pada mahasiswa jurusan ekonomi pembangunan yang berasal dari luar kota bengkulu analisis selisih biaya produksi pada perusahaan meubel putera setia kota bengkulu kajian faktor faktor penyebab rendahnya kualitas inti sawit berdasarkan kadar inti sawit pecah kadar kotoran inti sawit kadar air inti sawit ptpn vii talo pino bengkulu pertumbuhan stek mikro pembentukan umbi mikro kentang dengan pemberian chlorocholine chloride ccc pada suhu inkubasi yang berbeda analisis faktor faktor yang mempengaruhi perbedaan permintaan kendaraan bermotor roda dua kabupaten mukomuko pengaruh komposisi genetik terhadap performans produksi telur puyuh coturnix coturnix japonica umur 24 36 minggu hasil persilangan asal bengkulu padang yogyakarta inisiasi pembentukan akar mikro panili dengan pemberian beberapa konsentrasi naa naphthalene acetic acid arang aktif secara in vitro analisis dampak sosial ekonomi implementasi program pemberdayaan ekonomi masyarakat pesisir pemp kelurahan malabero kota bengkulu analisis komponen kimia akasia hybrid pemanfaatannya sebagai bahan baku pulp kertas perkembangan penyakit bercak daun cercospora tanaman kacang tanah arachis hypogaea l pada penggunaan pupuk organik anorganik evaluasi usaha sapi perah aspek finansial pada peternak peserta proyek kecamatan selupu rejang kabupaten rejang lebong daya hambat ekstrak biji caesalpinia pulcherrima l swartz terhadap pertumbuhan fusarium oxysporum schlecht penyebab rebah kecambah tomat karakteristik fisik lahan volume runoff daerah tangkapan pada lahan kelapa sawit belum menghasilkan adopsi teknologi usahatani stroberi kecamatan selupu rejang kabupaten rejang lebong jenis jenis tumbuhan yang dimanfaatkan oleh masyarakat desa batu ampar kecamatan kedurang kabupaten bengkulu selatan analisis faktor faktor yang mempengaruhi kepuasan pelanggan pada rumah sakit umum daerah dr m yunus bengkulu analisis pusat pertumbuhan ekonomi pada tingkat kecamatan kabupaten seluma propinsi bengkulu analisis permintaan ffisiensi pemasaran sawi pahit pada tingkat pedagang pengecer kota bengkulu kasus pasar panorama pasar minggu dry matter production and digestibility improvement of centrosema pubescens and pueraria phaseoloides with rock phosphate fertilization and vam inoculation jipi 9 1 1 5 1411 0067 tentang ukuran tubuh ternak kerbau hubungannya dengan berat badan pada peternakan sekitar taman hutan raya rajo lelo bengkulu pengaruh pekerjaan kompensasi kepemimpinan terhadap kepuasan kerja pegawai pada pdam kota bengkulu faktor penyebab putus sekolah pada masyarakat terpencil pada desa talang sawah kec bermani ilir kabupaten kepahiang pelaksanaan perlindungan anak nakal delinkuen proses peradilan pidana kota bengkulu flypaper effect pada dana alokasi umum dau pendapatan asli daerah pad terhadap belanja daerah pada kabupaten kota provinsi bengkulu aplikasi model daur belajar 5e pembelajaran biologi meningkatkan hasil belajar ipa biologi siswa kelas viic smpn 11 kota bengkulu analisis faktor yang mempengaruhi perkembangan pariwisata kota bengkulu ditinjau dari opinion leaders persepsi konsumen upaya peningkatan brand image strategi pemasaran pengaruh sistem pengolahan tanah pengendalian gulma terhadap hama daun kedelai musuh alaminya analisis penyerapan tenaga kerja sektor konstruksi propinsi bengkulu penyelesaian pelanggaran kesusilaan menurut hukum adat kecamatan muara bangkahulu kota bengkulu inventarisasi sebaran kura kura air tawar teresterial kabupaten bengkulu selatan analisis pendapatan petani kulit manis kasus kel desa lempur tengah kecamatan gunung raya kabupaten kerinci propinsi jambi pengaruh kepuasan kerja terhadap kinerja individual dengan kecerdasan emosional sebagai variabel pemoderasi empiris pada perbankan kota bengkulu analisis faktor faktor yang mempengaruhi alokasi waktu kerja kontribusinya terhadap pendapatan rumah tangga nelayan kasus nelayan malabero kota bengkulu pengaruh pemberian beberapa jenis umbi umbian terhadap produksi telur daya tetas telur jangkrik gryllus mitratus faktor faktor penentu keputusan ibu rumah tangga keluarga nelayan memilih bekerja atau tidak bekerja luar rumah tangga kasus desa pasar palik kec air napal kab bengkulu utara analisis pengaruh konsumsi investasi terhadap pdrb propinsi bengkulu analisis perencanaan pengendalian biaya volume produksi crumb rubber pada pt pamor ganda kabupaten bengkulu utara optimalitas pelayanan penerima bahan baku karet pada pt batanghari bengkulu pratama aplikasi teori antrian peranan kepala dinas tenaga kerja sosial kota bengkulu penyelenggaraan tugas fungsi analisis pada dinas tenaga kerja sosial kota bengkulu analisis faktor faktor sosial ekonomi yang mempengaruhi pendapatan wanita buruh tani sawit kontribusinya terhadap total pendapatan keluarga kasus desa riaksiabun kecamatan sukaraja kabupaten seluma provinsi bengkulu pengaruh komunikasi antarpribadi pimpinan terhadap motivasi kerja wartawan pada surat kabar harian rakyat bengkulu pemanfaatan azotobacter cma terhadap n total tanah serapan n serta pertumbuhan bibit durian durio zibethinus murr pada lahan bekas tambang batubara penerapan landasan syar i investasi mencegah investasi batil pada pt asuransi takaful cabang bengkulu pengaruh display atmosfire service retail terhadap perilaku impulse buying konsumen pada toko ritel kasus konsumen yang berbelanja toko happy mart analisis pengambilan keputusan memilih belajar sosiologi pada mahasiswa jurusan sosiologi fakultas ilmu sosial ilmu politik universitas bengkulu analisis break even point menetapkan harga jual volume produksi pada usaha pisang sale tuta mana curup kontribusi tenaga lapangan dikmas penyelenggaraan pendidikan luar sekolah kota bengkulu pertumbuhan stek mikro pembentukan umbi mikro kentang pada suhu inkubasi konsentrasi nitrogen coumarin yang berbeda pengaruh harga pendapatan selera terhadap volume penjualan kendaraan bermotor roda dua merek yamaha tipe mio pada pd panca motor bengkulu analisis perubahan jumlah penduduk tingkat upah terhadap perubahan jumlahtenaga kerja sektor pertanian kabupaten bengkulu utara docucom pdf trial perbedaan hasil belajar siswa dengan menggunakan metode konvensional metode kooperatif cooperative learning tipe stad pada pengajaran fisika smp negeri 3 kota begkulu preferensi makan peletakan telur kumbang penggerek umbi cylas formicarius f pada beberapa varietas ubi jalar ipomoea batatas l lamb strategi pemberdayaan masyarakat desa bengkulu in prosiding seminar nasional pengembangan usaha agribisnis perdesaan balai besar pengkajian pengembangan teknologi pertanian departemen pertanian bengkulu 13 20 978 979 1415 16 3 pelaksanaan tentang pembiayaan murabahah kepada usaha mikro oleh pt bank muamalat indonesia tbk cabang bengkulu karakteristik sosial ekonomi donatur pada lembaga pos keadilan peduli umat kota bengkulu analisis faktor faktor yang mempengaruhi sisa hasil usaha shu pada koperasi indonesia kekayaan jenis mamalia hutan lindung bukit lumut gedang hulu lais kecamatan lebong atas kabupaten lebong improving students ability in writing descriptive genre through inquiry teaching technique at the tenth grade of ma al hasanah pondok kelapa bengkulu utara academic year of 2006 2007 a classroom action research pengaruh perubahan earnings cash flow terhadap perubahan pembayaran dividen empiris pada perusahaan non keuangan yang terdaftar bej evaluation of mung bean genotypes possessing different seed coat characteristic for resistance to field weathering akta agrosia 10 2 142 149 1410 3354 relationship between seed coat lignin content and seed coat characteristics in mung bean jipi 9 1 6 11 1411 0067 storability of mung bean seeds possessing different seed coat lignin content under simulated adverse conditions akta agrosia 1 2 131 138 1410 3354 evaluation of mung bean genotypes for resistance to field and storage deterioration jipi 3 328 336 1411 0067 suplementasi minyak ikan lemuru sardinella longiceps niacin terhadap berat karkas uji organoleptik domba lokal efektifitas proses penjatuhan pidana terhadap pelaku tindak pidana perkosaan kota bengkulu pertumbuhan hasil sambiloto andrographis paniculata burmf ness pada beberapa dosis pupuk kandang konsentrasi em pada tanah ultisol 4 pengaruh pemberian beberapa jenis sayuran terhadap pertumbuhan bekicot achatina fulica umur 15 90 hari pengaruh pemberian janjang kosong kelapa sawit sebagai campuran media terhadap produktivitas cacing tanah pheretima sp hubungan faktor perilaku pemimpin dengan kinerja pegawai fakultas keguruan ilmu pendidikan universitas bengkulu analisis permintaan tenaga kerja pendapatan pada usahatani padi sawah irigasi kasus petani pengguna traktor non traktor desa batu roto kecamatan kerkap kabupaten bengkulu utara identifikasi permasalahan proses interaksi sosial yang dialami narapidana anak lembaga pemasyarakatan klas ii a bengkulu kejahatan seksual oleh bapak terhadap anak kandung kota bengkulu organoleptic characteristics of horse and beef nikumi on some leaching frequency analisa pengaruh modal kerja terhadap profitabilitas pada koperasi simpan pinjam ksp rizki curup kabupaten rejang lebong pengaruh bid ask spread market value risk of return terhadap holding period saham pada perusahaan yang tercatat indeks lq 45 periode 20052006 analisa rasio cost rc usaha ternak penggemukan sapi potong kasus desa sumber arun kec sukaraja kab seluma korelasi motivasi belajar biologi dengan prestasi belajar biologi siswa kelas viii smp n 7 kota bengkulu pendugaan fungsi keuntungan risiko usahatani sawi pahit brassicha juncea desa sambirejo kecamatan selupu rejang kabupaten rejang lebong pengembangan kegiatan belajar siswa melalui daur belajar deskriptif upaya meningkatkan pemahaman konsep sistem pernapasan pada siswa kelas xi ipa 3 sma n 1 kepahiang analisa pengeluaran pemerintah propinsi bengkulu pengaruh pengapuran pupuk kandang terhadap ketersediaan serapan hara p serta pertumbuhan semai lamtoro pada media tanah pasca tambang batubara analisis pengeluaran konsumsi perkapita propinsi bengkulu seleksi hibrid f1 kakao berproduksi tinggi pada fase bibit memanfaatkan analisis diskriminan in semirata dekan fakultas pertanian 23 26 juli 2007 riau submitted karakterisasi penampilan bibit kakao berproduksi tinggi akta agrosia 1 67 70 1410 3354 the effect of reduced impact logging to residual stand damage in the tropical natural forest a case study in forest concession areas of pt suka jaya makmur west kalimantan jipi 9 1 32 39 1411 0067 anali si s luas pr oduk si optimal pada usaha kk meubel jati harum sari bengkulu respon keong mas pomacea canaliculata lamarck terhadap pemberian ekstrak kulit jengkol buah pinang pada padi sawah analisis faktor faktor yang mempengaruhi produksi pendapatan nelayan menggunakan perahu mesin tempel kasus kelurahan pasar mukomuko analisis tingkat konsumsi produk syngenta pendapatan usahatani cabai kasus pada petani binaan pt syngenta kec selupu rejang kec bermani ulu kab rejang lebong pemerolehan kosakata bahasa indonesia anak usia 4 6 tahun tk dharma wanita lubuk durian bengkulu utara characteristics of soil chemistry developed on carbonate rock of baron wonosari transect jipi 9 2 139 147 1411 0067 analisis persepsi nasabah terhadap kualitas layanan jasa perbankan pada nasabah pt bank bengkulu cabang utama kondisi kesejahteraan keluarga petani komparatif pada petani mulsa plastik non mulsa plastik desa sumber urip desa sumber bening kecamatan selupu rejang kabupaten rejang lebong analisis faktor penentu kemiskinan masyarakat nelayan kota bengkulu kasus wilayah kandang pasar pantai pengaruh campuran beberapa media alas kandang terhadap pertumbuhan bekicot achatina fulica upaya penegakan hukum terhadap perambah hutan kawasan hutan lindung bukit daun kecamatan padang jaya kabupaten bengkulu utara analisis kualitas pelayanan rumah sakit rafflesia bengkulu aplikasi quality function deployment efektivitas penggunaan bakteri antagonis pegendalian penyakit layu bakteri pada tanaman jahe pertumbuhan stek bonggol pisang jantan pada berbagai konsentrasi interval pemberian pupuk organik cair ketidakadilan gender novel retno karya sakti wibowo analisis pertumbuhan ekonomi sektor industri propinsi bengkulu partisipasi masyarakat mendukung pelaksanaan pendidikan dusun iv suka mulya kecamatan girimulya kabupaten bengkulu utara praktek perkawinan antar suku bangsa pada masyarakat dikecamatan manna kabupaten bengkulu selatan perhitungan harga pokok produksi pada pabrik kerupuk rahayu kota manna upaya meningkatkan prestasi belajar dengan menerapkan tandur secara kooperatif tipe team games tournament tgt pada siswa sma negeri 8 kota bengkulu classroom action research kontribusi industri kecil tahu tempe terhadap peningkatan pendapatan remaja putus sekolah kasus pada industri kecil tahu tempe abib tahu tempe sumber mulya kota bengkulu pertumbuhan hasil sambiloto pada empat taraf dosis pupuk kandang konsentrasi pupuk daun pengaruh manajemen laba terhadap kinerja perusahaan pada perusahaan perbankan yang terdaftar bursa efek jakarta pertanggungjawaban pengemudi terhadap matinya orang lain akibat kecelakaan lalu lintas wilayah hukum pengadilan negeri sengeti kabupaten muaro jambi kepribadian lokus kendali eksternal lokus kendali internal konsumen pengguna kartu atm perilaku compulsive buying analisis penawaran tenaga kerja tidak tetap pemanen tebu kontribusi pendapatannya pada rumah tangga kasus desa ketiau kecamatan lubuk keliat kabupaten ogan ilir sumatera selatan model pendidikan partisipatif pada sekolah rakyat alternatif sra desa sumber urip kec selupu rejang kab rejang lebon g kohesi koherensi wacana artikel harian rakyat bengkulu analisis kemampuan kabupaten kota propinsi bengkulu melaksanakan otonomi daerah analisis pendapatan ibu rumah tangga nelayan kontribusinya terhadap pendapatan rumah tangga nelayan kasus desa lubuk tanjung kec air napal kab bengkulu utara reklasifikasi jenis tanah tropopsamments yang ada kota bengkulu a study of english teacher s teaching style at senior high school smu n 1 putri hijau north bengkulu analisa marketable surplus beras kasus desa dusun muara aman kecamatan lebong utara kabupaten lebong akta agrosia 10 1 32 39 1410 3354 analisa marketable surplus beras kasus desa dusun muara aman kecamatan lebong utara kabupaten lebong akta agrosia 10 1 32 39 1410 3354 perlindungan hak hak korban tindak pidana perkosaan menurut sistem peradilan pidana indonesia penerapannya wilayah hukum kota bengkulu respon pertumbuhan hasil beberapa varietas unggul padi sawah terhadap pembatasan jumlah anakan beberapa faktor yang mempengaruhi kinerja karyawan pt adira finance cabang bengkulu penerapan simple production crew proses produksi film indie deskriptif pada film it s almost there karya ariani darmawan perbedaan hasil cabai pada berbagai waktu penyiangan gulma karakteristik demografi konsumen jasa penerbangan domestik era multi operator kota bengkulu pengaruh faktor faktor rasional politik kultur organisasi terhadap pemanfaatan informasi kinerja instansi pemerintah daerah penampilan bibit pre nursery 10 kopi arabusta pada beberapa media tanam pengaruh pemberian zeolit alam ransum terhadap performans broiler penentuan harga pokok produksi kontribusi pendapatan usaha pemasaran brem desa gebang kecamatan nguntoronadi kabupaten wonogiri propinsi jawa tengah analisis potensi produksi kain batik besurek kota bengkulu analisis fungsi produksi persediaan pakan pada perusahaan tambak udang pt cendana prioritas lestari pt cpl pondok kelapa bengkulu utara penerapan pidana denda tindak pidana narkotika pengadilan negeri bengkulu aplikasi box jenkins peramalan produksi penjualan serta analisis respon penawaran cpo pt socfindo analisis vegetasi hutan lindung bukit lumut gedang hulu lais kecamatan lebong atas kabupaten lebong propinsi bengkulu pengaruh dosis pupuk k tingkat naungan buatan terhadap pertumbuhan hasil jahe gajah panen muda pengaruh perendaman kedelai berbagai konsentrasi larutan bikarbonat nahco lama waktu perebusan padapembuatan tauco tanpa 3 fermentasi awal analisis pelanggaran etika iklan pada iklan iklan surat kabar harian rakyat bengkulu analisis pei\'xebab kemiskinan masyarakat kelurahan beringin raya kecamatan muara bai\igkahulu kota bengkulu analisis ekspor karet indonesia periode 1989 2005 analisis faktor faktor lingkungan internal eksternal yang mempengaruhi perkembangan pariwisata kota bengkulu ditinjau dari persepsi opinion leaders konsumen serta implikasinya terhadap brand image strategi pemasaran pengaruh vegetasi pionir terhadap sifat sifat biologi tanah proses rehabilitasi lahan alang alang pengaruh penggunaan garam bawang putih pembuatan tempe dari berbagai varietas kedelai terhadap mutu daya terima konsumen pengaruh perusahaan yang membagikan dividen perusahaan yang tidak membagikan dividen terhadap return saham bej kajian pertumbuhan tanaman kumis kucing pada beberapa dosis pupuk kandang ayam karakteristik fisik tanah gambut pada berbagai tingkat produksi kelapa sawit wilayah irigasi mukomuko kanan efisiensi pendapatan usahatani padi sawah pada petani pengguna teknologi pengelolaan tanaman sumberdaya terpadu ptt berdasarkan status penguasaan lahan yang berbeda desa rimbo kedui kecamatan seluma selatan kabupaten seluma pertumbuhan stek kayu rapat parameria leavigata juss moldenke pada berbagai tingkat kepekatan lama perendaman dengan air kelapa muda the effect of personal photograph on students writing quantity in descriptive text a quasi experimental study on the second year students of sman 8 bengkulu in 2006 2007 academic year analisis pengaruh kualitas layanan kepuasan pelanggan terhadap loyalitas pelanggan kasus pada nasabah tabungan bank mandiri cabang ahmad yani bengkulu penataan ruang berbasis pertanian berkelanjutan perlindungan hak hak petani atas tanah pertanian kecamatan kerkap pengaruh ketepatan ramalan laba terhadap initial return saham pasar perdana pada pasar modal indonesia analisis struktur komposisi vegetasi tingkat pohon tiang hutan rawa air tawar kawasan cagar alam danau dusun besar caddb kota bengkulu differentiation in properties of vertisol from various parent materials jipi 9 1 20 31 1411 0067 pengaruh koefisien respon arus kas memprediksi harga saham perusahaan manufaktur yang tercatat bej pengaruh inokulasi berbagai isolat cma azotobacter terhadap pertumbuhan semai durian pada lahan pasca penambangan batubara land suitability and braak formula evaluation for potato cultivation in bukit kaba footslope bengkulu jipi 9 2 94 102 1411 0067 perilaku petani hortikultura sekitar taman wisata alam bukit kaba pelestarian sumberdaya alam kasus desa sumber urip kecamatan selupu rejang kabupaten rejang lebong organic versus non organic rice a case study of seed physiology of rice oryza sativa l local cultivar rojolele jipi 9 2 130 138 1411 0067 persepsi pelanggan perusahaan mengenai customer relationship isolasi steinernema dari tanah ekosistem tanaman cabai jagung bengkulu utara patogenisitasnya terhadap aphis gossypii glover analisis implementasi kebijakan pemerintah kota bengkulu menanggulangi gelandangan pengemis kasus kawasan jalan suprapto kota bengkulu analisis perkembangan ukm kota manna inventarisasi jenis tumbuhan yang dimanfaatkan oleh masyarakat desa talang tais dari kawasan hutan cagar alam talang tais kabupaten kaur propinsi bengkulu analisis tingkat kecukupan pangan gizi masyarakat nelayan kelurahanmalabero kota bengkulu analisis faktor faktor yang mempengaruhi status kemiskinan nelayan kelurahan kandang kecamatan kampung melayu kota bengkulu dampak program kemitraan petani kelapa sawit terhadap distribusi pendapatan petani plasma pt agricinal seblat faktor faktor yang mempengaruhi inflasi indonesia periode 19951 20054 pengaruh tokoh media massa program aksi partai keadilan sejahtera pks terhadap perilaku simpatisan pemilu legislatif 2004 pada masyarakat simpatisan pks kecamatan muara bangkahulu kota bengkulu evaluasi jalur hijau kota arga makmur hutan kota bengkulu taman remaja analisis pengaruh kebijakan moneter fiskal terhadap inflasi indonesia periode tahun 1981 2005 pengaruh bahan tanam desuckering terhadap pertumbuhan hasil pisang jantan karakteristik fisik tanah iklim mikro lingkungan tumbuh amorphophallus titanum kawasan hutan bengkulu pemanfaatan beberapa jenis kulit pisang pembuatan nata de banana skin ditinjau dari pengaruh lama waktu fermentasi pertumbuhan dua jenis anakan pisang ambon curup pada intensitas cahaya matahari yang berbeda pertumbuhan gulma hasil padi gogo terhadap dosis mulsa eceng gondok efektif mikroorganisme em pada lahan bekas alang alang 4 kajian kinerja stasiun pelayuan pada proses pengolahan teh oolong pt trisula ulung megasurya kepahiang bengkulu the use of coconut liquid waste and soybean soaking water as culture media of bacillus thuringiensis barliner bacteria jipi 9 1 64 70 1411 0067 pengaruh pemberian tepung biji karet hevea brasiliensis muel arg terhadap kualitas karkas ayam kampung pada umur 16 minggu pengaruh keterlibatan pengambilan keputusan motivasi berprestasi terhadap kepuasan kerja karyawan pt bank muamalat tbk cabang bengkulu hubungan kredibilitas penyiar radio lesitta 1019 fm dengan minat dengar siswa pada siswa sma negeri 2 bengkulu kelas xii korelasi antara penguasaan istilah serapan dengan kemampuan membaca pemahaman siswa kelas vii smpn 1 kota bengkulu tahun pelajaran 2006 2007 pertumbuhan tanaman pembentukan umbi mikro kentang pada suhu inkubasi nitrogen cholorocholine cloride ccc yang berbeda analisis tren kinerja keuangan ptpn vii unit usaha ketahun kabupaten bengkulu utara pengaruh pemberian kapur terhadap pertumbuhan hasil galur galur harapan kedelai keturunan varietas malabar x kipas putih analisis perbedaan pendapatan pengemudi angkutan kota kota bengkulu kasus pada pengemudi angkutan kota trayek a 3 b1 evaluasi pengelolaan pusat latihan gajah bukit serelo lahat sumatera selatan persepsi warga belajar terhadap kepemimpinan tutor proses pembelajaran keterampilan pada pkbm panti asuhan al mubaarak kota bengkulu struktur kepemilikan good corporate governance investasi nilai perusahaan suatu pengujian sistem persamaan simultan tehnik pengolahan tanah pengendalian gulma pengaruhnya terhadap serangan perusak polong kedelai parasitoidnya pada lahan bekas ilalang pelaksanaan perjanjian kerjasama antara bank muamalat dengan pt pos indonesia persero tentang tabungan shar e kota bengkulu keragaan setek mikro tanaman kentang pada populasi tanam ukuran polybag yang berbeda pengaruh resiko sistematis volume perdagangan saham terhadap tingkat pengembalian saham pada perusahaan lq 45 periode januari desember 2005 introduksi tithonia pupuk kandang sapi terhadap sifat biologi ultisol serta hasil padi gogo pengaruh pemberian pupuk organik cair pada berbagai konsentrasi frekuensi terhadap tanaman kakao pembibitan optimasi pemanfaatan lahan lebak menyangga produksi tanaman pangan karakteristik biofisik lahan lebak in kongres ilmu pengetahuan wilayah indonesia bagian barat 3 juni 2007 kampus universitas sriwijaya jl padang selasa bukit besar palembang laporan hasil penelitian fundamental tahun 2007 uji laboratorium sifat sifat limbah organik mekanisme remediasi air asam tambang project report lembaga penelitian universitas bengkulu universitas bengkulu perlindungan hukum terhadap pengguna jasa kspedisi angkutan darat pada cv telaga biru kota bengkulu characteristic and effication essay of natural compound chitosan to post harvest anthracnose pathogen colletotrichum musae jipi 9 1 58 63 1411 0067 kajian ekologi burung pada kawasan hutan mangrove hutan pantai teluk berhawe pulau enggano kabupaten bengkulu utara keanekaragaman jenis diversifikasi pisang buah musa spp desa pekan selasa kecamatan pauh duo kabupaten solok selatan propinsi sumatera barat analisis kepuasan konsumen terhadap pelayanan jasa sriwijaya air deskriptif program pembelajaran remedial fisika oleh guru fisika smp negeri kota bengkulu hubungan word of mouth negatif purchase intention pada jasa perbankan telekomunikasi transportasi pengiriman barang internet respon galur galur harapan kedelai hasil persilangan varietas malabar kipas putih terhadap frekuensi pemberian air pengaruh lingkungan kerja terhadap kepuasan kerja produktivitas kerja perawat rsud dr m yunus bengkulu isolasi steinernema dari tanah pada pertanaman jagung bengkulu bagian selatan patogenesitasnya terhadap spodoptera litura f impact of land cover changes on actual evapotranspiration jipi 9 1 12 19 1411 0067 determination of crop coefficient using ground based climatologically data and vegetation index derived from noaa avhrr satellite jipi 9 2 165 171 1411 0067 efikasi cendawan metarrhizium anisopliae sor beauveria bassiana vuill terhadap spodoptera litura f anatomi organ reproduksi kura kura garis hitam cyclemis oldhamii kura kura patah dada cuora amboinensis in seminar herpetologi indonesia 26 27 mei 2007 bogor laporan penelitian hibah bersaing identifikasi anatomi molekuler anak anak cebol sedt spohdylo epiphyseal dysplasia tarda serta upaya peningkatan kelayakan hidupnya kedurang bengkulu selatan project report lembaga penelitian universitas bengkulu bengkulu populasi penyandang perawakan pendek berpaut kromosom x spondylo epiphyseal dysplasia tarda sedt wilayah kedurang bengkulu selatan in seminar pemantauan hasil penelitian hibah bersaing 17 19 desember 2007 jakarta pengaruh inokulasi azotobacter cma terhadap ketersediaan p serapan p pertumbuhan bibit durian durio zibethinus murr pada lahan pasca tambang batubara faktor faktor yang mempengaruhi mahasiswa baru memilih universitas muhammadiyah bengkulu pengaruh investasi domestik suku bunga infrastruktur jalan terhadap pdrb riil propinsi bengkulu 1986 2005 analisis implementasi program education permintaan kayu gergajian berdasarkan kelompok jenis ukuran sortimen kabupaten rejang lebong kajian perubahan struktur perekonomian ketimpangan antara sektor pertanian sektor non pertanian dipropinsi bengkulu the analysis of english teachers techniques in varying teaching activities a study on the english teachers at smpn 11 bengkulu effect of hydrogen peroxide h 2o2 on white degree and nutrient value of the black swiftlet nest kajian tentang penetasan telur walet collocalia fuciphaga keanekaragaman jenis anggrek orchidaceae bukit lumut hutan lindung bukit gedang hulu lais reg28 kecamatan lebong atas kabupaten lebong propinsi bengkulu pengaruh persepsi risiko terhadap perilaku keluhan perilaku berpindah pelanggan pada praktek dokter kota bengkulu an analysis of word translation by the sixth semester students of english study program universitas bengkulu in academic year 2006 2007 kandungan informasi pengumuman stock split bursa efek jakarta analisis abnormal return menggunakan beta koreksi penerapan political marketing terhadap preferensi kepribadian pemilih pemula memilih tipe kepemimpinan calon walikota bengkulu periode 2007 2012 gene action of the rust disease resistance in groundnut jipi 9 2 172 177 1411 0067 effect of sauropus androgynus extract on egg quality and internal organ weight in layers change in chemical composition of cassava leaves fermented by em4 tekanan penduduk terhadap kawasan taman nasional kerinci seblat tnks provinsi jambi persepsi mahasiswa tentang pelaksanaan prinsip prinsip pemerintahan yang baik pada pemerintah kota bengkulu pada mahasiswa fakultas ilmu sosial ilmu politik universitas bengkulu analisis strategi pemasaran gramoxone segmen petani lahan sawah kabupaten bengkulu selatan analisis perbedaan kinerja berdasarkan karakteristik biografis pada ppl bipp kota bengkulu analisis shift share dinamik pada perekonomian kota bengkulu analisis sistem pengukuran kinerja suatu pendekatan balanced scorecard kasus pada pt bank bengkulu cabang utama analisis persediaan bahan baku usaha efisiensi operasional produksi pada perusahaan meubel karya jepara argamakmur kabupaten bengkulu utara sistem agribisnis padi sawah berbasis modal sosial kasus kelurahan kemumu kecamatan kota argamakmur kabupaten bengkulu utara peran ganda wanita sebagai ibu rumah tangga wanita karier ditinjau dari segi hukum islam analisis pengaruh pemilihan metode akuntansi terhadap harga saham volume penawaran saham perdana suatu pertimbangan metode akuntansi jenis industri tanggung jawab sosial perusahaan agricinal pengembangan masyarakat sekitar pada pt agricinal desa koto bani desa air muring kecamatan putri hijau kabupaten bengkulu utara inventarisasi keanekaragaman jenis jenis kepadatan ikan muara sungai ketahun kecamatan ketahun kabupaten bengkulu utara populasi penyebaran itik talang benih kecamatan curup kabupaten rejang lebong respon pertumbuhan hasil beberapa galur harapan kedelai hasil persilangan varietas malabar kipas putih terhadap pemupukan fosfor p pelaksanaan peralihan hak atas tanah transmigrasi desa rimbo kedui kecamatan seluma selatan kabupaten seluma analisis faktor faktor yang mempengaruhi keputusan konsumen memilih produk syngenta atau non syngenta kasus pada retailer kota arga makmur upaya peningkatan keaktifan hasil belajar siswa melalui penerapan model diskusi kelompok terarah focus group discussion pada materi tata surya kelas vii c smp negeri 9 kota bengkulu classroom action research analisis prilaku konsumen memilih kursus komputer bengkulu study kasus lpk ampera komputer bengkulu analisis kualitas layanan jasa terhadap tindakan pasca pembelian konsumen memilih pencucian mobil darin kota bengkulu analisis struktural terhadap kemiskinan petani padi kasus desa karang anyar kecamatan lebong tengah kabupaten lebong pertumbuhan hasil tanaman sorgum pada jenis dosis pupuk kandang yang berbeda pemerolehan keterampilan hidup life skill terhadap anggota kelompok petani peternak sapi jenis bali deskriptif kualitatif desa sidodadi kec arga makmur kab bengkulu utara faktor faktor yang berhubungan dengan produktivitas kontribusi penghasilan tenaga kerja wanita pemetik teh ptp nusantara vi kayu aro kabupaten kerinci propinsi jambi respon pertumbuhan hasil sorgum terhadap dosis pupuk n jarak tanam yang berbeda sebaran keragaman populasi mikroorganisme tanah pada berbagai sistem budidaya tanaman desa sumber urip efektivitas pemberian pupuk npk terhadap pertumbuhan damar mata kucing shorea javanica k & v pada tanah podsolik merah kuning lahan stasiun percobaan universitas bengkulu identifikasi morfologi ayam hutan merah jantan gallus gallus analisis struktur tenaga kerja indonesia perkembangan penyaluran dana perum pegadaian kepada masyarakat cabang kota bengkulu pengaruh dosis pupuk nitrogen tingkat naungan terhadap pertumbuhan hasil jahe gajah panen muda analisis pengaruh investasi kebijakan pemerintah terhadap pertumbuhan ekonomi propinsi bengkulu perkembangan penyakit busuk rimpang pertumbuhan jahe akibat perlakuan ekstrak buah kelapa pada rimpang bibit analisis penawaran transmisi harga ekspor kopi indonesia aspek persuasif pada iklan media elektronik analisis wacana pergeseran gulma hasil cabai pada berbagai waktu penyiangan perkembangan fenotip penentuan genotip rflp pcr restriction fragment length polymorphism polymerase chain reaction pada satu keluarga albinisme kecamatan kedurang bengkulu selatan analisis optimasi biaya angkut pupuk pada pt bio nusantara teknologi bengkulu patogenisitas cendawan beauveria bassiana bals vuill pada larva penggerek cabang mangga rhytidodera simulans white coleoptera cerambycidae efek inokulasi jamur akar putih pada 10 provenan bibit nangka kota bengkulu tingkat partisipasi wanita bekerja kecamatan ratu agung kota bengkulu analisis sikap konsumen terhadap produk roti sariwangi bengkulu penerapan pembelajaran remedial dengan metode tutorial sebaya meningkatkan hasil belajar matematika siswa kelas vii smp negeri 6 kota bengkulu classroom action research serangan penggerek cabang pada dua varietas mangga mangifera indica l mangifera odorata grift kecamatan muara bangkahulu analisis isi berita pendidikan pada harian perjuangan terbitan tahun 2003 pertumbuhan hasil padi surya dengan berbagai dosis em 4 abu sekam pada tanah gambut aplikasi campuran glyfosat 2 4 d terhadap pertumbuhan hasil jagung pada sistem tot lahan alang alang analisis kinerja pemungutan pbb pengaruh nilai jual objek pajak terhadap penerimaan pbb kota bengkulu kasus kecamatan gading cempaka kelurahan kebun dahri pemanfaatan tithonia diversifolia sebagai subtitusi pupuk n p k terhadap pertumbuhan hasil tanaman padi gogo perbandingan hasil belajar matematika siswa antara pembelajaran menggunakan metode penemuan discovery dengan pembelajaran tradisional kelas i smk negeri 3 bengkulu pengaruh motivasi kompensasi disiplin kerja lingkungan kerja terhadap prestasi kerja karyawan perusahaan surat kabar rakyat bengkulu kajian penggunaan faktor faktor produksi terhadap perencanaan produksi susu kemasan cup pada perusahaan koica kabupaten rejang lebong kelayakan finansial pendirian industri penggilingan beras desa pondok panjang kecamatan lubuk pinang kabupaten mukomuko efisiensi ekonomi usahatani padi pada dua tipologi lahan yang berbeda propinsi bengkulu faktor faktor determinannya akta agrosia 2 155 163 1410 3354 kedudukan pembagian kewenangan suami istri sistim perkawinan ambek anak pada masyarakat suku besemah pada masyarakat dusun jokoh kelurahan jokoh kecamatan dempo tengah kotamadya pagaralam propinsi sumatera selatan pengaruh kompensasi kebijakan perusahaan terhadap produktivitas kerja karyawan pada pt gudang garam tbk cabang bengkulu perbedaan sifat fisika tanah produksi kelapa sawit pada beberapa vegetasi penutup tanah kasus pt bio nusantara bengkulu analisis perhitungan harga pokok produksi pada usaha kue inga bengkulu perbandingan pengajaran berbasis komputer dengan pengajaran tradisional terhadap prestasi belajar siswa kelas xi ipa sman 6 bengkulu pada pokok bahasan dinamika analisis faktor faktor yang berhubungan dengan tingkat partisipasi anggota upkd pasca proyek brdp kasus upkd sidodadi desa sidodadi kecamatan pondok kelapa kabupaten bengkulu utara teachers techniques in reducing anxiety in english classes a study in sma negeri 1 bengkulu faktor faktor yang mempengaruhi pendapatan pedagang sayur berkendaraan sepeda motor konstribusinya terhadap pendapatan rumah tangganya kota bengkulu identifikasi strategi belajar siswa berprestasi pada mata pelajaran fisika kelas xi ipa sma negeri 2 kota bengkulu merakit teknologi produksi kentang solanum tuberosum l dataran rendah dengan aplikasi anti gibberellins anti ga modifikasi suhu rhizosfer penelitian tahun pertama project report lembaga penelitian universitas bengkulu bengkulu unpublished age and weight of layer eggs distributed in bengkulu proximate composition of cured nikumi surimi like of some meat kinds washed leached by different comminution methods analisis efektifitas fungsi pemerintahan kelurahan surabaya kasus kelurahan surabaya kecamatan sungai serut kota bengkulu genetic and phenotypic correlation between first lactating milk production and milk production ability for fries holland cows faktor penyebab transmigran lokal menetap tinggal pemukiman kasus transmigran lokal desa bukit makmur sp 4 penarik kecamatan teras terunjam kabupaten mukomuko penerapan paket teknologi tanaman obat upaya memasyarakatkan toga desa sidomulyo kecamatan seluma selatan kabupaten seluma dharma raflesia 5 1 31 41 1693 8048 pertumbuhan hasil tanaman tempuyung sonchus arvensis l pada berbagai intensitas naungan kadar lengas dataran rendah jipi 2 200 207 1411 0067 rofil lulusan balai latihan kerja blk provinsi bengkulu tentang lulusan jurusan menjahit tahun 2004 mencari pekerjaan modeling permintaan ekspor kelapa sawit indonesia in prosiding seminar memposisikan pembangunan pertanian sebagai strategis penanggulangan kemiskinan kebodohan fakultas pertanian universitas riau riau 309 313 perilaku harga pemasaran ikan hasil tangkapan propinsi bengkulu agrisep 5 2 11 22 1412 8837 sectoral lingkage and key sector in province bengkulu economy input output analysis jipi 9 2 77 84 1411 0067 keterkaitan sektor sektor utama struktur perekonomian propinsi bengkulu 2000 2004 jurnal agribisnis industri pertanian 6 3 195 2006 1412 8888 peran kepemimpinan sebagai variabel pemoderasi hubungan budaya organisasional dengan keefektifan organisasioanal empiris pada perusahaan bumn bidang jasa cabang bengkulu populasi manajemen pemeliharaan itik talang benih kelurahan talang benih kecamatan curup kabupaten rejang lebong potensi lahan produksi tanaman jagung zea mays l pada tanah mineral kawasan sukaraja kabupaten seluma propinsi bengkulu peranan proyek pelatihan keterampilan tenaga kerja pktk oleh dinas transmigrasi tenaga kerja sosial bengkulu utara upaya memberikan kesempatan kerja bagi pemuda pengangguran kasus peserta yang mengikuti proyek pktk kecamatan kota argamakmur kabupaten bengkulu utara kecernaan total digestible nutrient tdn ransum dengan tabut blok pada sapi fh laktasi jipi 3 322 327 1411 0067 deskriptif tentang keterampilan guru fisika mengelola kelas sman 1 seluma sman 1 semidang alas maras kabupaten seluma inventarisasi jenis tumbuhan yang dimanfaatkan oleh masyarakat sekitar hutan bukit dendan kawasan hutan lindung bukit daun kasus desa kandang kecamatan seberang musi kabupaten kepahiang genetic variation heritability gene action and genetic advance of soybean on ultisol jipi 9 2 183 190 1411 0067 upaya meningkatkan hasil belajar kimia siswa kelas xi ipa sma negeri 6 kota bengkulu dengan penerapan penggabungan b metode peta konsep diskusi pengaruh budaya organisasi kepemimpinan motivasi terhadap kinerja karyawan pada badan perencanaan pembangunan daerah bappeda provinsi bengkulu penggunaan tepung terigu tepung beras tepung tapioka tepung maizena terhadap tekstur sifat sensoris fish nugget ikan tuna kinerja saham perusahaan pengakuisisi sekitar pengumuman akuisisi perusahaan manufaktur yang listed bej analisis isi siaran pers press release humas pemerintah bengkulu analisis faktor faktor produksi pendapatan peternak sapi perah desa air duku apk bandung kecamatan selupu rejang kabupaten rejang lebong perkembangan penyakit busuk rimpang pertumbuhan jahe akibat perlakuan rimpang bibit ke ekstrak teh faktor faktor yang mempengaruhi prestasi kerja karyawan pada pt bank negara indonesia persero tbk cabang bengkulu analisis pertumbuhan hasil padi gogo pada dua jenis bahan organik jarak tanam berbeda penerapan hukum penguasaan tanah perumahan bagi golongan ekonomi lemah kota bengkulu perbandingan hasil belajar kimia siswa pada pembelajaran yang menerapkan metode inkuiri melalui perumusan hipotesis pengujiannya dengan pembelajaran yang tidak menerapkan metode inkuiri kelas xi ia sma negeri 4 kota bengkulu penampilan bibit pre nurseri 10 kopi arabusta pada beberapa konsentrasi pupuk daun persepsi konsumen terhadap bonus kemasan pada produk shampo kasus shampo sunslik pantine clear yang memiliki bonus kemasan pengaruh kecemasan menghadapi ujian terhadap prestasi belajar fisika siswa kelas iii ipa sma negeri 4 bengkulu hubungan kemampuan verbal visual terhadap kemampuan numerik siswa pada konsep cahaya kelas viii smp n 3 kota bengkulu analisis pengaruh belanja pembangunan tenaga kerja pengeluaran rutin terhadap pembangunan daerah kabupaten bengkulu utara analisa potensi prospek pariwisata wilayah pesisir kota bengkulu sebagai kawasan pariwisata internasional hubungan antara pengetahuan dasar kependidikan penguasaan materi pengajaran dengan keterampilan mengajar guru fisika smp negeri kota bengkulu english for nurse academy students a needs analysis a study at ‘ akper of bengkulu province karakteristik air tanah pada beberapa tanah ordo ultisol modifikasinya melalui pemberian mulsa pengaruh kompetisi pengembangan karir terhadap prestasi kerja karyawan pada pt columbindo perdana kota bengkulu analisis kehadiran fasa spinel mgal2o4 pada sistem komposit keramik al2o3 mgo exacta 5 2 90 94 1412 3617 analisis anatomi batang kelapa sawit elaeis quinensis jack ditinjau dari dimensi serat proporsi sel current state in the diagnosis of blood parasite babesia sp effectiveness of polyethilene glycol as a selective agent on gamma irradiated patchouli calii for tolerance to drought stress jipi 9 1 48 57 1411 0067 ketahanan alami kayu manis cinnamomun burmani bl umur 3 6 12 tahun terhadap serangan rayap tanah analisis pelaksanaan promosi jabatan pada staf administrasi universitas bengkulu pertumbuhan bibit kelapa sawit elaeis guineensis jacq pembibitan utama akibat perbedaan konsentrasi frekuensi pemberian pupuk pelengkap cair analisis faktor faktor yang berhubungan dengan perubahan pola usahatani padi ke usahatani cabai desa penanjung panjang kecamatan tebat karai kabupaten kepahiang pengaruh pemberian pakan kroto sarang walet terhadap perkembangan bulu keberhasilan pemeliharaan anak burung walet putih collocalia fuciphaga hasil penetasan distribusi target stan daerah pelagis dengan menggunakan sistem akustik split beam rength ik perairan pulau enggano analisis faktor keberhasilan pada pelaksanaan program bantuan usaha kecil menengah meningkatkan kesejahteraan kelompok petani kopi study kasus pada kelompok tani kopi desa tanjung lengkayap kec lengkiti kabupaten ogan komering ulu sum sel analisis pengaruh struktur modal return on assets terhadap nilai perusahaan manufaktur yang listed bej analisis efektivitas pelaksanaan kebijakan pajak restoran kota bengkulu kasus pada kantor dipenda kota bengkulu inventarisasi jenis ikan sungai ketahun pada zona riam zona kuala kecamatan ketahun kabupaten bengkulu utara analisis efektivitas pengaruh media e pr pt astra internasional tbk astra world menumbuhkan iklim komunikasi kasus pada astra world medan performance pedet sapi perah fries holland fh dari lahir sampai umur tiga bulan ditinjau dari ukuran tubuh bobot badan analisis pendapatan petani padi sawah distribusinya pada berbagai sistem pengairan kecamatan seluma analisis tentang kriminalitas remaja study kasus pada remaja kelurahan mubai kecamatan lebong selatan kabupaten lebong kajian mutu telur ayam ras utuh selama penyimpanan dengan metode pelapisan cangkang shell sealing analisis tingkatan loyalitas merek pada konsumen produk telepon seluler nokia kasus pada beberapa outlet nokia cell kota bengkulu analisis pengendalian persediaan bahan baku kasus pada perusahaan roti holland bakery kota bengkulu sistem akuntansi manajemen persepsi ketidakpastian lingkungan desentralisasi kinerja organisasi analisis hubungan nilai sortasi tandan buah segar tbs terhadap mutu rendemen cruide palm oil cpo serta kehilangan minyak ptpn vii talo pino bengkulu pengaruh pemberian azotobacter cma dari berbagai sumber isolat terhadap pertumbuhan semai surian toona sureni merr lahan bekas tambang batubara lapang pt danau mas hitam kabupaten bengkulu utara perilaku masyarakat terhadap perubahan sistem adat perkawinan suku rejang kasus desa turan lalang kecamatan lebong selatan kabupaten lebong faktor faktor yang mempengaruhi adopsi petani pada budidaya padi sawah sistem legowo jipi 3 300 306 1411 0067 pelaksanaan kumulasi gugatan perceraian dengan gugatan pembagian harta bersama yang disertai permohonan sita jaminan pengadilan agama kota bengkulu peranan alat bukti keterangan terdakwa penyelesaian perkara pidana pengadilan negeri bengkulu pengaruh kadar air akhir pelayuan suhu penyangraian menghasilkan emping melinjo berkualitas baik analisis isi siaran radio santana 103 5 fm bengkulu berdasarkan pasal 36 1 uu no 32 tahun 2002 tentang penyiaran analisis faktor faktor produksi efisiensi alokatif pemasaran usahatani ikan nila dengan sistem keramba jaring apung kel siogung ogung kec pangururan kab samosir sumut analisis komoditas perkebunan unggulan meningkatkan pertumbuhan ekonomi kabupaten kepahiang propinsi bengkulu hubungan komponen pertumbuhan komponen hasil dengan hasil tanaman sorgum analisis kelayakan sosial finansial pembuatan tambak udang kabupaten mukomuko propinsi bengkulu aktivitas jasad renik pertumbuhan kedelai akibat pemberian rhizobium sp cma pendekatan kontekstual dengan menggunakan metode kooperatif jenis jigsaw sebagai upaya meningkatkan hasil belajar fisika pada konsep kalor kelas vii e smp negeri 2 kota bengkulu classroom action research performa alat pengering sederhana bertenaga listrik terhadap pengeringan udang baring mysidaceae penampilan agronomis galur harapan kedelai hasil persilangan varietas malabar kipas putih pada tanah ultisol persepsi mahasiswa akuntansi bengkulu terhadap etika penyusunan laporan keuangan keterjangkauan petani terhadap media informasi pada anggota petani pemakai air kp2a kecamatan seginim kabupaten bengkulu selatan analisis persepsi perempuan dewasa tentang serial jewel in the palace efektifitas metarrhizium anisopliae metch sorokin terhadap aphis cracivora koch pengaruh manajemen laba terhadap kinerja operasi return saham identifikasi mutu bahan olahan karet rakyat bokar sebagai bahan baku pembuatan sir 20 kasus pada 3 kecamatan penghasil bokar propinsi bengkulu faktor yuridis penyebab pemecahan tanah pertanian wilayah transmigrasi kecamatan pondok kelapa kabupaten bengkulu utara penyelesaian tindak pidana pencurian yang disertai dengan kekerasan melanggar pasal 365 kuhp pengadilan negeri bengkulu analisis pengaruh locus of control etika terhadap hubungan antara kapasitas individu dengan budgetary slack empiris pada perusahaan asuransi kota bengkulu pertumbuhan dua jenis anakan pisang kepok pada beberapa dosis pupuk kalium kajian ekologi jenis jenis burung hutan mangrove teluk klowe pulau enggano kabupaten bengkulu utara analisis faktor faktor yang mempengaruhi keputusan konsumen memilih produk syngenta atau non syngenta kasus pada petani sayur kecamatan selupu rejang kabupaten rejang lebong pengaruh saat pemangkasan varibtas teriiadap keberiiasilan okulasi bibit mangga umur satu tahun pasang surut otonomi desa peraturan perundang undangan republik indonesia perlindungan hukum perjanjian antara koperasi nelayan mengenai hasil perikanan lautdi wilayah pasar bengkulu pengaruh penambahan bahan aromatik sukrosa terhadap penerimaan konsumen biaya pembuatan emulsi minyak sawit merah analisa sektor unggulan kabupaten bengkulu selatan sebelum sesudah pemekaran analisis saluran distribusi terhadap margin pemasaran ikan laut kota bengkulu perbedaan prestasi akademik antara mahasiswa yang memiliki gaya belajar visual auditorial kinestetik analisas faktor faktor yang mempengaruhi kepuasan kerja karyawan perusahan daerah air minum kota bengkulu inventarisasi tumbuh tumbuhan yang dimanfaatkan oleh masyarakat sekitar hutan desa gajah makmur sp8 kecamatan muko muko selatan kabupaten muko muko pemanfaatan bahan kapur pupuk mikrob perbaikan sifat kimia tanah hasil kedelai pada ultisol bengkulu analisis fungsi keuntungan usahatani cabai merah keriting pada daerah dataran tinggi daerah dataran rendah propinsi bengkulu kasus desa sumber bening kabupaten rejang lebong desa sukasari kabupaten seluma kajian kualitas pelayanan perpustakaan pada badan perpustakaan propinsi bengkulu pengaruh perbandingan pakan rucah ikan usus ayam terhadap pertumbuhan labi labi hutan dogonia subplana penampilan bibit pre nursery 10 kopi arabusta pada beberapa tingkat naungan peranan ketua kaum menyelesaikan perselisihan perkawinan menurut hukum adat masyarakat desa pondok panjang kecamatan lubuk pinang kabupaten mukomuko analisis tata letak peralatan pabrik meningkatkan kelancaran material handling proses produksi kasus ptbatanghari bengkulu pratama analisis koordinasi biro kesra provinsi bengkulu strategi pengarustamaan gender pug kampanye sebagai media periklanan mempengaruhi preferensi pemilih pemilihan calon walikota bengkulu analisis curahan waktu kerja hubungannya dengan pendapatan wanita pedagang pengecer sayuran kasus kota bengkulu evaluasi kinerja panen pada perkebunan teh ptpn vi kayu aro kerinci jambi pertumbuhan biomassa sambiloto pada berbagai jenis pupuk organik pengaruh stereotip terhadap efektifitas komunikasi antarbudaya pada hubungan antara suku duano dengan suku bugis kampung nelayan kuala tungkal upaya peningkatan aktivitas siswa bertanya menjawab belajar kelas melalui pembelajaran fisika dengan menggunakan keterampilan bertanya dasar pada kelas i ma pancasila bengkulu 2007 classroom action research pengaruh pemberian sampah organik sebagai campuran media terhadap produktivitas cacing tanah pheretima sp patogenisitas cendawan nomuraea spp terhadap spodoptera litura f lepidoptera noctuidae kajian tentang kondisi sosial ekonomi masyarakat petani kemiri aleurites mullucana willd desa pungguk pedaro kecamatan lebong selatan kabupaten lebong peranan tumbuhan pionir pada perubahan sifat sifat tanah pasca tambang batubara penerapan hukum adat pekal terhadap pelaku perzinaan solusinya dikaitkan dengan hukum islam desa air buluh kecamatan muko muko selatan kabupaten muko muko penggunaan tepung keong mas terhadap pertumbuhan berudu kodok lembu rana catesbeiana shaw isolasi senyawa flavonoid fraksi polar dari aun gaharu a quil laria m alac ce ns is uji antimalaria pada mencit m us mu sc ulu s swiss webster jantan impeachment terhadap presiden dan atau wakil presiden menurut hukum tata negara indonesia perilaku penurunan kadar air daun nilam sebagai akibat proses pengeringan dengan alat pengering tray dryer project report lembaga penelitian unib unpublished pengaruh perilaku berpindah switching behavior perilaku keluhan complaining behavior pelanggan terhadap kepercayaan merek brand trust pada perusahaan financial service pada jasa bank leasing asuransi penerapan teori belajar thorndike dengan metode latihan driil upaya peningkatan hasil belajar siswa pada konsep suhu pemuaian kelas vii semester i sltpn 10 kota bengkulu tahun ajaran 2007 2008 a classroom action ressearch tentang perolehan keterampilan profesi pijat tradisional sebagai alternatif pelayanan kesehatan bagi masyarakat kasus pada pemijat tradisional desa srikaton kecamatan pondok kelapa kabupaten bengkulu utara the parents' strategies in motivating elementary school students to learn english at home in sdn 02 curup sub district of bengkulu fungsionalisasi petugas pengamanan mewujudkan pembinaan narapidana berdasarkan sistem pemasyarakatan lembaga pemasyarakatan klas iia bengkulu studens' difficulties in doing the reading section of toefl a study at the fifth semester student of english department of universitas bengkulu pengaruh kinerja keuangan terhadap harga saham pada perusahaan non manufaktur non keuangan bursa efek jakarta pengaruh pelatihan kerja pendidikan lingkungan kerja terhadap prestasi kerja karyawan pada pt telkom tbk area pelayanan bengkulu analisis reaksi pasar berdasarkan praktik perataan laba bursa efek indonesia the effort of economics teachers on teaching learning analisis faktor faktor yang mempengaruhi penyerapan tenaga kerja pada industri kecil kota bengkulu biografi h hasan zen sh mm pekerja keras pantang menyerah in biografi h hasan zen sh mm pekerja keras pantang menyerah yayasan john hi ‐ tech idetama jakarta 8 17 979 9619394 analisis desentralisasi fiskal kota bengkulu terhadap peningkatan kualitas sektor pendidikan pada era otonomi daerah pengaruh brand image toyota kijang terhadap loyalitas konsumen membeli mobil toyota kijang innova pembinaan narapidana perkosaan yang lanjut usia lembaga pemasyarakatan klas ii a lubuklinggau analisis pengawasan mutu komoditas karet standar ekspor pada pt bukit angkasa makmur analisis six sigma pada kualitas pelayanan rawat inap rumah sakit rafflessia bengkulu egg production and yolk color of coturnix coturnic japonica fed diet containing indigofera leaf meal pengaruh human capital social capital terhadap inovasi karyawan pada pt asuransi jiwasraya persero branch office bengkulu area office marlborough pengaruh budaya organisasi lingkungan kerja terhadap kinerja karyawan pada pt telekomunikasi telkom cabang bengkulu proses penemuan hukum rechtsvinding oleh hakim peradilan perdata pengadilan negeri lubuklinggau manajemen laba pada perusahaan publik yang melakukan employee stock ownership program esop analisis faktor faktor yang mempengaruhi produktivitas tenaga kerja sektor pertanian propinsi bengkulu pelaksanaan pelatihan keterampilan tenaga kerja pktk bidang keterampilan meubel dinas tenaga kerja transmigrasi bengkulu utara tahun 2007 analisis penerimaan pajak kendaraan bermotor bea balik nama kendaraan bermotor propinsi bengkulu aplikasi qfd quality function deployment pada travel bengkulu indah keanekaragaman nimfa odonata dragonflies beberapa persawahan sekitar bandung jawa barat exacta 6 2 41 50 1412 3617 kelompok anak remaja delinquent masyarakat rejang pengaruh personal background political background pengetahuan dewan tentang anggaran terhadap peran dprd pengawasan keuangan daerah pengaruh pelayanan terhadap kepuasan nasabah pt bank central asia tbk cabang bengkulu pengaruh atribut produk terhadap keputusan pembelian produk minuman coca cola kasus pada beberapa rumah makan jalan suprapto kota bengkulu analisis preferensi nasabah pada perbankan kota bengkulu kinerja keuangan pemerintah daerah sebelum sesudah pemberlakuan anggaran berbasis kinerja kasus pemerintahan kota bengkulu korelasi antara kompetensi guru pengelolaan pembelajaran persepsi guru tentang keterampilan manajerial kepala sekolah dengan motivasi kerja guru sd negeri kecamatan gading cempaka kota bengkulu pengaruh economic value added eva return on assets roa return on equity roe terhadap nilai pasar saham pt gudang garam perbandingan keakuratan model arus kas operasi metode langsung tidak langsung memprediksi arus kas dividen masa depan implementasi tugas guru sekolah menengah atas analisis saluran distribusi obat golongan bebas pada pt indofarma global medika cabang bengkulu analisis karakteristik masyarakat miskin kecamatan bermani ilir kabupaten kepahiang sistem tanam legowo pemberian p stater pada padi sawah dataran tinggi akta agrosia 11 2 102 107 1410 3354 analisis fungsi pesan nonverbal interaksi belajar anak autis slbn kota bengkulu laporan penelitian dosen muda populasi penyandang perawakan pendek berpaut kromosom x spondylo epiphyseal dysplasia tarda sedt wilayah kedurang bengkulu selatan project report lembaga penelitian universitas bengkulu bengkulu the quality of casting of three earthworm species at different watering and lime applications perlindungan hukum terhadap konsumen pelanggan air minum pada perusahaan daerah air minum pdam kabupaten lebong pemanfaatan software atoms symbols and equations meningkatkan kualitas pembelajaran kimia dasar triadik 11 2 159 171 8053 8301 analisis pengaruh lokasi harga pelayanan fasilitas ragam produk terhadap keputusan berlangganan kartu halo pengaruh pemberian ekstrak kulit batang tanaman gaharu aquilaria malaccensis terhadap konsentrasi motilitas spermatozoa mencit analisis faktor faktor yang mempengaruhi angka partisipasi sekolah kasar sumatera kasus bengkulu sumatera utara pengaruh pendidikan kesehatan terhadap pdrb propinsi bengkulu relegiositas sains al qur an as sunnah kajian ilmu syariah ilmu tasauf kutei 15 1 11 1412 9639 applying struktur komposisi vegetasi mangrove hutan mangrove pulau baai bengkulu agriculture 12 2 394 401 1412 4262 seasoned equity offerings antara agency theory windows of opportunity kinerja perusahaan analisis pengukuran kinerja berdasarkan metode balanced scorecard pada pt bank bengkulu cabang utama penetapan pola produksi usaha meningkatkan efisiensi biaya produksi susu bubuk kedelai murni sha 253 pada perusahaan syahida kota bengkulu analisis faktor faktor yang mempengaruhi masyarakat memilih produk tabungan shar e pada pt bank muamalat indonesia cabang bengkulu the correlation between scrotal circumference and body size of kacang goat at different rearing system analisis pengaruh tingkat suku bunga pendapatan nasional terhadap permintaan uang indonesia periode 1984 2005 analisis faktor faktor yang mempengaruhi permintaan listrik kecamatan muara bangkahulu pengaruh size risk sinking fund auditor terhadap prediksi peringkat obligasi penerapan pendekatan kontekstual pembelajarankimia sebagai upaya meningkatkan aktivitas hasil belajar siswa kelas xi ipa1 sman 1 ketahun bengkulu utara exacta 6 2 17 22 1412 3617 pengaruh kandungan informasi komponen laporan arus kas laba kotor size perusahaan terhadap expected return saham study empiris perusahaan manufaktur pada bursa efek indonesia analisis efektivitas rekruitmen politik menciptakan kader yang profesional kasus dewan pimpinan wilayah partai persatuan pembangunan provinsi bengkulu analisis perbandingan pendapatan petanijagung kelompok non kelompok desa air sulau kecamatan kedurang kabupaten bengkulu selatan membangun loyalitas penumpang penerbangan lion air melalui emotional branding nak luar nikah kajian komparatif antara undang undang nomor 1 tahun 1974 tentang perkawinan analisis hubungan perubahan organisasi dengan kinerja karyawan lembaga penyiaran publik lpp rri bengkulu hubungan pendapatan pendidikan terhadap pilihan jasa pelayanan alat kontrasepsi kasus kelurahan ibul kecamatan kota manna kabupaten bengkulu selatan strategi pemasaran meningkatkan volume penjualan pada toko elektronik jimy musik bengkulu dissolved and labile particulate zr hf nb ta mo and w in the western north pacific ocean journal of oceanography 64 247 257 1573 868x pemanfaatan kitin kitosan dari cangkang udang sebagai adsorben ion mangan terlarut air analisis perbedaan kinerja keuangan antara perusahaan yang melakukan stock split dengan perusahaan yang tidak melakukan stock split bursa efek indonesia kemampuan laba arus kas memprediksi laba arus kas masa depan persepsi mahasiswa akuntansi universitas bengkulu terhadap praktik praktik kecurangan fraud pengaruh free cash flow terhadap return dengan moderasi set kesempatan investasi investment opportunity set siklus hidup perusahaan life cycle of firm analisis faktor faktor yang mempengaruhi kinerja usaha anggota up3hp kota bengkulu analisis deskriptif faktor faktor yang mempengaruhi keberhasilan program bantuan ukm study kasus pada koperasi karya utama kec banding agung kab ogan komering ulu selatan prov sumatera selatan perubahan tingkat suku bunga kinerja pasar modal analisis pada tingkat pasar tingkat industri analisa perencanaan kebutuhan bahan baku pada usaha kerupuk ikan belido rawa makmur bengkulu analisis kehidupan sosial ekonomi anak jalanan kota bengkulu analisis faktor faktor yang mempengaruhi kinerja sistem informasi akuntansi empiris pada kantor cabang perbankan kota bengkulu pengaruh kepuasan kerja lingkungan kerja terhadap kinerja pegawai uptd balai proteksi tanaman pangan holtikultura dinas pertanian ketahanan pangan propinsi bengkulu manajemen sarana pendidikan pada sma negeri kabupaten mukomuko uji kausalitas defisit anggaran pendapatan belanja negara apbn dengan tingkat bunga indonesia pengaruh motivasi disiplin kerja lingkungan kerja terhadap prestasi kerja dosen akuntansi kota bengkulu the soil health biologically in contaminated tomato soil with fusarium oxysporum fsp lycopersici akta agrosia 11 2 180 187 1410 3354 pembelajaran fisika model cooperative learning type stad meningkatkan proses hasil belajar pada konsep wujud zat kelas vii b smpn 2 kota bengkulu exacta 6 2 23 29 1412 3617 analisis permintaan beras propinsi bengkulu analisis retribusi parkir kota bengkulu analisis yuridis putusan pengadilan agama mengenai sengketa ekonomi syariah perspektif undang undang nomor 3 tahun 2006 tentang peradilan agama analisis tataniaga kambing kota bengkulu pengaruh user relatedfactors terhadap kualitas hasil pengembangan sistem informasi pengelolaan sarana prasarana praktik meningkatkan mutu pendidikan pada smk negeri 3 lubuklinggau analisis efektivitas program unit pelayanan pengembangan pengolahan hasil pertanian up3hp kota bengkulu pemanfaatan ekstrak biji kelor moringa oleifera lamk dengan tanpa kulit ari sebagai koagulan zat warna reaktif larutan model limbah cair industri kain besurek faktor faktor yang mempengaruhi upah minimum provinsi bengkulu provinsi sumatera selatan pola amar maruf mabadi khayrul ummah pancasila inspirasi 17 1 44 50 0854 4808 analisis faktor yang membedakan adanya overeducation jabatan awal yang diperoleh alumni perguruan tinggi kota bengkulu pengaruh citra kepuasan pelanggan terhadap loyalitas pelanggan pada salon spa rudy hadisuwarno bengkulu pengaruh kejelasan sasaran anggaran terhadap senjangan anggaran instansi pemerintah daerah dengan komitmen organisasi sebagai pemoderasi pengaruh kepuasan kerja komitmen organisasional terhadap intensi keluar dosen kasus pada universitas muhammadiyah bengkulu analisis pengaruh kurs tingkat bunga jumlah uang beredar m2 terhadap pendapatan nasional indonesia pengaruh ukuran perusahaan leverage siklus hidup perusahaan terhadap relevansi laba arus kas operasi menjelaskan return saham hubungan periklanan personal selling dengan keputusan muzakki membayar zakat pada badan amil zakat daerah bazda provinsi bengkulu analisis faktor faktor yang mempengaruhi pendapatan nelayan tradisional kota bengkulu kasus kelurahan pasar bengkulu growth performances of white and brown quail coturnix coturnic japonica the preparation and contribution first graduate program of science and technology in education professional career in international seminar on continuing professional development conference hall rectorat university of bengkulu unib pengaruh mekanisme corporate governance investment opportunity set ios terhadap kualitas laba nilai perusahaan pengaruh kepemimpinan budaya organisasi terhadapkepuasan kerja kinerja karyawan pada pt perkebunan nusantara vii persero unit usaha padang pelawi responses of surya rice varieties on hull ash dosages and seedling ages akta agrosia 11 2 119 125 1410 3354 pengaruh kepuasan pelanggan sebagai indikator kinerja non keuangan terhadap pendapatan perusahaan pada industri jasa rumah sakit kota bengkulu hubungan belanja modal dengan belanja pemeliharaan pada pemerintah kabupaten kota kasus wilayah sumatera bagian selatan analisis dampak penambangan pasir desa air padang kecamatan lais kabupaten bengkulu utara the effort to improve the discipline of new students of viia class through applying teacher modeling an action research at junior high school number four lubuklinggau perbedaan sebelum sesudah ex dividen date terhadap return saham bursa efek jakarta bej pengaruh disiplin kerja insentif kerja terhadap produktivitas kerja karyawan pt federal internasional finance fif cabang kota bengkulu hubungan antara dana alokasi umum belanja modal pendapatan asli daerah pendapatan per kapita analisis pola pendapatan pengeluaran rumahtangga nelayan kecamatan pasar manna kabupaten bengkulu selatan keakurasian pendeteksian citra wajah dengan jaringan syaraf tiruan back propagation kepercayaan terhadap teknologi sistem informasi baru evaluasi kinerja individual analisis pengaruh pertumbuhan penduduk pertumbuhan ekonomi pertumbuhan angkatan kerja terhadap tingkat pengangguran propinsi bengkulu performance of male and female talang benih duck growth reared intensively pengaruh kesadaran lingkungan pada niat beli hijau perilaku konsumen terhadap pembelian kosmetik ramah lingkungan beberapa faktor yang mempengaruhikinerja karyawan pt bank bengkulu cabang argamakmur persepsi mahasiswa akuntansi terhadap kasus manajemen laba etika pelaporan keuangan pengaruh partisipasi pemakai terhadap kepuasan pemakai pengembangan sistem informasi dengan tiga variabel moderating pengaruh pemberian steroid dari kulit batang tanaman gaharu aquilaria malaccensis terhadap kemampuan motorik aktivitas seksual mencit mus musculus bulb c deskripsi lingkungan kerja kepuasan kerja karyawan pt pos indonesia persero cabang bengkulu upaya penyediaan bibit pisang 'ambon curup' unggulan propinsi bengkulu melalui pembentukan planlet secara in vitro tahun kedua project report lembaga penelitian universitas bengkulu unpublished upaya penyediaan bibit pisang ambon curup unggulan propinsi bengkulu dengan pembentukan planlet secara in vitro project report lembaga penelitian universitas bengkulu unpublished analisis deskriptif dampak negatif pendirian plta musi terhadap ekonomi masyarakat kasus desa karang panggung kec pagar jati kab bengkulu utara changes in seed quality of mung bean genotypes with different seed characteristics as affected by field weathering during maturity stages akta agrosia 11 2 144 150 1410 3354 genotypic variation in mung beans possessing different seed coat characteristics for resistance to incubator weathering akta agrosia 11 1 34 40 1410 3354 analisis konsumsi beras rumah tangga prasejahtra kecamatan teluk segara kota bengkulu aplikasi logika fuzzy metode tsukamoto memprediksi potensi serangan stroke persepsi konsumen terhadap personal selling wiraniaga melakukan penjualan amdk mas bengkulu eksistensi pengaturan pajak provinsi meningkatkan pendapatan asli daerah pemerintahan provinsi bengkulu pengembangan model e learning fisika sebagai bentuk virtual classroom media informatika 6 2 1 17 0854 4743 virtual classroom fisika sebagai media efektif belajar fisika penerapan teknologi informasi forum teknik majalah ilmiah teknologi 32 2 101 121 0216 7565 virtual classroom sebagai wadah pengembangan inteligensi ganda penerapan teknologi informasi forum teknik majalah ilmiah teknologi 32 3 185 198 0216 7565 effect of manila duck meat and cassava powder on chemical composition and organoleptic properties of meat ball analisis sosial ekonomi petani karetdi kecamatan talang iv kabupaten bengkulu utara keragaman jenis burung yang diperdagangkan kota padang provinsi sumatera barat jurnal penelitian lembaga penelitian universitas bengkulu 14 2 110 115 0852 405x analisis faktor yang mempengaruhi keputusan konsumen membeli sepeda motor merek ktm bengkulu analisis pertumbuhan ekonomi antar daerah provinsi bengkulu keterkaitan corporate governance mechanisms terhadap agency cost kasus pada perusahaan food and beverages yang listed bei manajemen sma rintisan sekolah standar nasional kabupaten musi rawas mencapai standar nasional pendidikan peralihan penguasaan yuridis hak atas tanah wakaf menurut hukum tanah nasional hukum islam kajian peranangan kompor sekam analisis permintaan tenaga kerja provinsi bengkulu the certification effect to the teacher work at smp negeri 1 in lubuklinggau city pengaruh motivasi pengetahuan personalitas terhadap minat mahasiswa akuntansi mengikuti pendidikan profesi akuntansi ppak precise isotopic analysis of mo in seawater using multiple collector inductively coupled mass spectrometry coupled with a chelating resin column preconcentration method analytical chemistry 80 23 9213 9219 0003 2700 analisis pengaruh pengeluaran pembangunan pengeluaran rutin tenaga kerja terhadap pembangunan daerah provinsi bengkulu metode abc sebagai dasar pengalokasian biaya pengobatan pada rumah sakit umum kepahiang reaksi pasar saham terhadap pengumuman peringkat obligasi pengelolaan kelas yang berbasis pembelajaran aktif kreatif sebagai upaya meningkatkan pemahaman mahasiswa tentang pengendalian gulma project report lembaga penelitian universitas bengkulu oligosaccharides an alternative to antibiotics growth promotant a review analisis marketable surplus faktor faktor yang mempengaruhi marketed supply serta ketersediaan kota bengkulu agrisep 7 2 97 108 1412 8837 pengaruh informasi laba arus kas komponen arus kas terhadap harga saham pengaruh konflik peran stres kerja terhadap komitmen organisasi pada akuntan pemerintah bpkp perwakilan bengkulu analisis kemampuan keuangan kota bengkulu menjalankan otonomi daerah perlindungan hukum terhadap penerima fidusia ditinjau dari undang undang nomor 42 tahun 1999 tentang jaminan fidusia audit sumber daya manusiadi universitas bengkulu uji kausalitas antara inflasi dengan ekspor impor barang jasa indonesia periode 1987 2006 pengaruh pertumbuhan ekonomi pendapatan asli daerah dana alokasi umum terhadap pengalokasian anggaran belanja modal pada kabupaten kota provinsi se sumbagsel hubungan fungsi kepemimpinan dengan motivasi kerja pegawai pada dinas pasar kota bengkulu pertumbuhan hasil jarak pagar pada berbagai pola jarak tanam lahan marginal project report lembaga penelitian universitas bengkulu bengkulu unpublished analisis kepuasan pelanggan terhadap kualitas produk kartu halo pascabayar study pada koperasi telkomsel kota bengkulu analisis pengaruh angkatan kerja kapital terhadap pertumbuhan ekonomi provinsi bengkulu discipline implementation in public junior high school number 12 lubuklinggau pembinaan narapidana residivis lembaga pemasyarakatan narkotika klas ii a lubuklinggau faktor faktor yang mempengaruhi proses pembelajaran akuntansi berdasarkan persepsi mahasiswa akuntansi universitas bengkulu analisis kebijakan pendidikan gratis kota bengkulu pengaruh aliran kas internal kepemilikan manajer perusahaan terhadap pembelanjaan modal pengujian terhadap managerial hypothesis pecking order hypothesis kasus pada perusahaan manufaktur yang tercatat bej analisis pajak bumi bangunan pbb sektor pedesaan perkotaan kabupaten bengkulu selatan analisis faktor faktor yang mempengaruhi penanaman modal asing pma indonesia pengaruh pemahaman wajib pajak badan mengenai undang undang pajak penghasilan terhadap penghematan pajak penghasilan empiris pada perusahaan dagang kota bengkulu kandungan informasi pengumuman stock split terhadap likuiditas saham yang diukur denganbid ask spread volume perdagangan bursa efek jakarta pengaruh anggaran pendidikan perkapita anggaran kesehatan perkapita terhadap proporsi penduduk miskin kota bengkulu pengaruh pertumbuhan ekonomi indeks harga konsumen kebutuhan hidup layak terhadap upah minimum propinsi propinsi bengkulu analisis selisih biaya operasional pada po fa ratu agung kota bengkulu morfogenetika kucing rumah felis domesticus desa jagobayo kecamatan lais bengkulu utara bengkulu exacta 6 2 30 41 1412 3617 analisis kepuasan konsumen atas pelayanan pada bandara fatmawati bengkulu pengaruh budaya organisasi pelatihan pengembangan terhadap kinerja perawat pada rumah sakit umum daerah dr m yunus bengkulu analisis kinerja pemerintah bidang pendidikan ditinjau dari kepuasan tenaga pendidik unit cost pendidikan tipologi pengangguran kota bengkulu interest 11 1 85 92 1410 8828 tinjauan yuridis bank garansi perjanjian pemborongan persepsi mahasiswa akuntansi terhadap tanggung jawab auditor komparasi antar perguruan tinggi kota bengkulu persepsi mahasiswa akuntansi terhadap tanggung jawab auditor komparasi antar perguruan tinggi kota bengkulu pemanfaatan limbah tatal karet sebagai arang aktif penyerapan ion seng terlarut air pengembangan multimedia interaktif mpi pada praktikum fisika dasar i exacta 6 2 9 16 1412 3617 remediasi air asam tambang dengan limbah organik in round table discussion ehxibition penyusunan rencana aksi mitigasi antisipasi dampak pemanasan global regional sumatera kalimantan mewujudkan ketahanan pangan 14 15 maret 2008 universitas sriwijaya palembang unpublished pertumbuhan eksplan pisang ambon curup dengan pemberian 2 4 d sukrosa secara in vitro aris romadan bawah bimbingan ir marlin m sc ir mukhtasar m si 2009 40 halaman analisis faktor faktor yang mempengaruhi produksi padi pada usahatani padi sawah irigasi kasus kelurahan dusun besar kota bengkulu pemeliharaan herpetofauna langka monouria emys heosemys spinosa sebagai sumber belajar konservasi ex situ kebun biologi universitas bengkulu in workshop bagi dosen mahasiswa tentang pemeliharaan herfetofauna langka sebagai sumber belajar konservasi ex situ 1 desember 2008 bengkulu laporan penelitian unggulan pengembangan potensi kulit batang gaharu aquilaria malaccensis seabagai perangsang seks aphriodisiac provinsi bengkulu project report lembaga penelitian universitas bengkulu bengkulu laporan penelitian pengembangan bahan ajar cal biologi perkembangan hewan meningkatkan pemahaman mahasiswa tentang tanggung jawab sosial project report lembaga penelitian universitas bengkulu bengkulu pengaruh pengeluaran pembangunan angkatan kerja terhadap pertumbuhan ekonomi provinsi bengkulu ekonomi perencanaan pembangunan 1 1 10 18 1979 7338 analisis uji kausalitas antara penerimaan pajak dengan pengeluaran pemerintah kota bengkulu periode 1993 2007 kebijakan perpajakan daerah sektor kendaraan bermotor sebagai upaya meningkatkan pendapatan asli daerah provinsi bengkulu ditinjau dari hukum administrasi negara keberlanjutan perlindungan induksi resistensi sistemik oleh mikoriza vesikuler arbuskular glomus sp pada tanaman tomat terhadap fusarium oxysporum akta agrosia 11 1 75 79 1410 3354 pengaruh kecerdasan emosional terhadap pemahaman pengetahuan akuntansi tingkat pengantar the influence of investment and labour to the value of small industry production in province of bengkulu penilaian kinerja bank muamalat indonesia cabang bengkulu dengan pendekatan balanced scorecard sebuah eksploratori pertanggungan kebendaan sebagai penjaminan praktek perbankan analisis makro ekonomi kota bengkulu sebelum setelah kebijakan otonomi daerah analisis pertumbuhan ekonomi danketimpangan pembangunan propinsi bengkulu relevansi nilai dividend yield price earning ratio per penilaian harga saham dengan level investment opportunity set ios sebagai variabel pemoderasi pengaruh pengetahuan keterampilan kompensasi terhadap kinerja karyawan panti sosial bina laras psbl dharma guna bengkulu the efforts of the school principal in increasing teachers discipline qualitative descriptive study at state junior high school of muara beliti musi rawas district analisis faktor faktor penentu perkembangan usaha binaan program up3hp kota bengkulu pengaruh pengetahuan dewan transparansi kebijakan publik terhadap peran dprd pengawasan apbd dengan partisipasi masyarakat sebagai variabel moderating study empiris pada dprd provinsi kota bengkulu persepsi konsumen terhadap kualitas pelayanan happpy world bengkulu analisis sektor ekonomi potensial pengaruhnya terhadap pendapatan asli daerah pad kabupaten rejang lebong analisis apbd kabupaten kota wilayah sumatera bagian selatan sumbagsel pada era otonomi daerah correlation of the teacher teaching competence and the using of teaching aids with mathematic learning behaviour at state junior high school at bengkulu municipality dasar pertimbangan hakim menjatuhkan putusan verstek pengadilan agama klas ia bengkulu pengaruh peranan sistem informasi akuntansi kualitas informasi akuntansi terhadap pengambilan keputusan keuangan pada perusahaan perbankan kota bengkulu lighting program for broiler penetapan standar waktu proses produksi pakaian seragam putih sekolah menengah atas study kasus toko abang pramuka toko siaga bengkulu sebagai pembanding gmo aman dikonsumsi? harian rakyat bengkulu the basis for glyphosate resistance in rigid ryegrass lolium rigidum from california weed science 56 2 181 188 0043 1745 pengaruh kepuasan kerja keterlibatan kerja terhadap kinerja pegawai pada dinas transmigrasi tenaga kerja sosial kabupaten bengkulu utara manajemen program pendidikan anak usia din memacu pembentukan umbi mikro tanaman kentang yang ditanam secara in vitro pada suhu tinggi dengan aplikasi ancymidol paclobutrazol ccc coumarin in prosiding seminar nasional pekan kentang 2008 departemen pertanian lembang 88 75 978 979 8257 35 3 merakit teknologi produksi kentang solanum tuberosum l dataran rendah dengan aplikasi anti gibberellins anti ga modifikasi suhu rhizosfer penelitian tahun kedua project report lembaga penelitian universitas bengkulu bengkulu unpublished komitmen anggota dprd terhadap pembangunan pendidikan kabupaten mukomuko evaluation of application of technical short run impacts of tariff reforms on regional employment in indonesia a multiregional computable general equilibrium approach in prosiding seminar bidang ilmu pertanian bks ptn wilayah barat banda aceh syiah kuala university press banda aceh 492 502 978 97 9 8278 33 4 status wanita ketahanan pangan rumah tangga nelayan petani padi kabupaten mukomuko provinsi bengkulu jurnal agro ekonomi 26 2 191 207 0216 9053 kajian pemilihan zone proyeksi utm pemetaan kawasan lintas batas zone media teknik 30 1 93 98 0216 3012 pengaruh generalisasi unit lahan pada besarnya erosi kasus das air nelas propinsi bengkulu jurnal ilmu kehutanan 2 1 1 11 0126 4451 the library persepsi konsumen terhadap tabloid soccer kota bengkulu reaksi pasar atas kinerja finansial ketepatan publikasi laporan keuangan restrukturisasi delik kesusilaan rangka pembaharuan hukum pidana materil indonesia tinjauan kritis terhadap kejahatan seksual pemanfaatan kitin kitosan dari cangkang kepiting sebagai adsorben zat warna reaktif pada larutan model limbah cair industri kain besurek prediksi kondisi financial distress dengan menggunakan analisis multinomial logit empiris pada perusahaan non keuangan yang terdaftar bursa efek indonesia the perception of the principals to the managerial competences of the principals of state senior high school in bengkulu city based on permendiknas ri no 13 2007 persepsi konsumen membeli sepeda motor honda kota bengkulu penerapan media pembelajaran audiovisual pada matakuliah pendahuluan fisika inti exacta 6 1 35 40 1412 3617 evaluasi tata letak peralatan pabrik meningkatkan efisiensi curriculum analisis faktor faktor marketing mix yang mempengaruhi konsumen membeli produk elektronik pada spektra bengkulu pengaruh struktur kepemilikan risiko terhadap kebijakan utang perusahaan sebuah perspektif agency theory analisis struktur pasar perilaku kinerja industri jasa penerbangan domestik indonesia analisis kualitas pelayanan pt federal international finance cabang bengkulu aplikasi quality function deployment analisis anggaran realisasinya sebagai alat bantu manajemen mengukur efektivitas efisiensi perusahaan kasus pada perusahaan daerah air minum pdam kota bengkulu pengaruh gibberellic acid ga3 terhadap daya pertumbuhan awal kecambah semangka non¬biji citrullus vulgaris schard pengaruh informasi asimetri group cohesiveness terhadap hubungan antara partisipasi penganggaran senjangan anggaran pengaruh stres kerja terhadap tingkat kinerja auditor faktor demografi sebagai variabel pemoderasi the principal strategies for development the mathematic teachers at public senior high school number 5 in lubuklinggau analisis faktor faktor yang mempengaruhi permintaan minyak tanah kelurahan panorama analisis dampak alih fungsi lahan pertanian terhadap kondisi sosial ekonomi masyarakat kasus kecamatan seluma kota kabupaten seluma fungal infection at coffee beans during primary processing case study in bengkulu province akta agrosia 11 1 87 95 1410 3354 penyelesaian sengketa yang timbul dari transaksi e_commerce melalui arbitrase online plant regeneration from leaf blade explants of horseradish amoracia rusticana l through in vitro culture akta agrosia 11 1 63 68 1410 3354 the study of young teacher construction dynamics study of qualitative descriptive at public elementary school 21 of north mukomuko district of mukomuko realisasi program pengembangan karyawan meningkatkan kinerja rumah sakit rafflesia kota bengkulu pengaruh kejelasan sasaran anggaran pengendalian akuntansi sistem pelaporan terhadap akuntabilitas kinerja instansi pemerintah daerah kota bengkulu dampak publikasi laporan keuangan terhadap perilaku return saham bursa efek indonesia bei empiris pada perusahaan manufaktur yang terdaftar bei periode 2001 2005 impact bruise resistance of palm fruit teknologi industri pertanian 18 1 25 27 0216 3160 analisis kualitas pelayanan bengkel service honda ahass 07674 cabang bengkulu aplikasi quality function deployment pengaruh in store shoping exprienceterhadapa retensipelanggan distributoroutlet kota bengkulu model perekonomian regional in modeling perekonomian regional pendekatan model input output aplikasinya badan penerbitan fakultas pertanian universitas bengkulu bengkulu 7 22 978 602 96609 4 4 penggunaan metode simulasi meningkatkan motivasi hasil belajar siswa pada mata pelajaran pkn kelas v sekolah dasar negeri 86 kota bengkulu pengelolaan lembaga bimbingan belajar kota lubuklinggau deskriptif kualitatif lembaga bimbingan belajar primagama gilland ganesha zaki college kontribusi hasil perolehan keterampilan kerajinan kulit lantung peningkatan pendapatan keluarga kasus pada pengrajin kulit lantung jaya agung craft bengkulu pengaruh dosis kompos pupuk p terhadap al dd serapan p pertumbuhan kentang hitam pada ultisol pengaruh konsentrasi lama inkubasi jamur phanerochaeta chrysosporium terhadap kadar holoselulosa alpha selulosa batang mangium acacia mangium willd sebagai bahan baku pulp kelayakan teknis finansial pembuatan biobriket dari limbah padat kelapa sawit dengan metode pengarangan analisis hubungan keterampilan kemampuan motivasi dengan kinerja pegawai lingkungan dinas pendapatan daerah provinsi bengkul u kompetensi guru ipa fisika smp negeri kabupaten kaur melakukan praktikum laboratorium peranan bantuan kelompok usaha bersama kube meningkatkan keberfungsian sosial penyandang cacat tubuh kasus pada kube ‘bina usaha desa tebing kaning kecamatan kota argamakmur kabupaten bengkulu utara analisis ketahanan pangan rumah tangga petani padi kabupaten mukomuko provinsi bengkulu analisis tingkat kualitas pelayanan jasa hotel vista bengkulu dengan metode six sigma pelaksanaan pengawasan melekat meningkatkan disiplin kerja pegawai lingkungan kantor wilayah departemen hukum ham propinsi bengkulu analisis pengawasan atasan langsung pada kantor camat kecamatan manna kabupaten bengkulu selatan strategi pendayagunaan dana zakat badan amil zakat baz kota bengkulu memecahkan problem kemiskinan kota bengkulu analisa sikap perilaku industri kecil gula aren kabupaten rejang lebong aplikasi model sains teknologi masyarakat stm secara kooperatif pembelajan biologi meningkatkan kompetensi siswa kelas xi ipa sman 9 kota bengkulu analisis aktivitas kehumasan tvri bengkulu mebentuk citra lembaga meningkatkan hasil belajar matematika siswa melalui model pembelajaran berbasis masalah smpn 2 kepahiang kecerdasan emosional mahasiswa ' belajar bahasa inggris deskriptif tahun pertama siswa smpn 22 kota bengkulu pada tahun akademik 2008 2009 analisis ketersediaan air danau dendam tak sudah dengan menggunakan metode nreca humor appeals towards brand awareness in advertising meningkatkan siswa membaca pemahaman dengan menggunakan student tim prestasi divisi stad teknik mahasiswa tahun kedua dari smkn 4 bengkulu tahun akademik 2009 2010 upaya meningkatkan berpikir kritis melalui penerapan model problem based learning terhadap hasil belajar pkn siswa kelas v sekolah dasar negeri 03 kota bengkulu skala usaha daya saing usaha industri kecil gula aren kabupaten rejang lebong pengaruh kemampuan disiplin kerja kompensasi lingkungan kerja terhadap prestasi kerja pegawai pdam kota bengkulu analisis jaringan komunikasi komunitas waria rejang lebong mendapatkan informasi seputar usaha salon kecantikan kasus ikatan keluarga waria rejang lebong ikwrl kurikulum muatan lokal bahasa rejang berbasis pendekatan komunikatif smp pengaruh pertambahan penduduk terhadap pertumbuhan ekonomi kota bengkulu kasus tahun 1995 2005 kajian berbagai konsentrasi frekuensi pemberian pupuk daun terhadap pertumbuhan bibit salak pengaruh waktu inkubasi jamur phanerochaete chrysosporium terhadap degradasi komponen kimia campuran batang cabang acacia mangium willd penggunaan pendekatan konstruktivisme teknik berpikir berpasangan berempat meningkatkan prestasi belajar siswa pada mata pelajaran pkn kelas ivc sd negeri 19 kota bengkulu penerapan model pengajararan langsung direct instruction dengan pendekatan analitik meningkatkan hasil belajar matematika siswa kelas viii e smp negeri 1 pondok kelapa pengaruh sumber daya manusia terhadap kinerja pegawai lingkungan sekretariat daerah provinsi bengkulu pengaruh efektivitas komunikasi antar pribadi terhadap motivasi kerja pada atasan bawahan lembaga penyiaran publik televisi republik indonesia bengkulu persepsi konsumen membeli produk distro pada oecok jeans distro bengkulu analisis dampak perubahan organisasi bagi kinerja pegawai lingkungan sekretariat daerah kota bengkulu pengaruh faktor intrinsik terhadap kepuasan kerja pada karyawan pt astra honda motor bengkulucabang padang jati bengkulu analisis kualitas pelayanan kesehatan pada puskesmas basuki rahmad kecamatan selebar kota bengkulu akumulasi resin gaharu dengan berbagai teknik inokulasi konsentrasi fusarium sp isolat pisang pada aquilaria malaccensis lamk analisis kepemimpinan camat pembinaan penyelenggaraan pemerintahan desa kecamatan karang tinggi kabupaten bengkulu tengah analisis titik impas sebagai dasar perencanaan laba pada usaha peternakan ayam ras petelur kasus pada gunuang nago group kota padang provinsi sumatera barat pengaruh pemberian talas colocasia esculenta terhadap produksi telur itik talang benih karakterisasi ketahanan beberapa genotipe jagung lahan ultisol perubahan pola penguasaan lahan pada masyarakat tepian hutan kasus masyarakat desa tapus kecamatan topos kabupaten lebong fenomena facebook berkurangnya interaksi sosial dunia nyata pada facebook group raflesia muda club pengaruh gaya kepemimpinan lingkungan kerja penilaian prestasi kerja terhadap motivasi kerja pegawai pada badan perencanaan pembangunan daerah bappeda kota bengkulu pengaruh pemberian ekstrak etanol daun kelor moringa oleifera terhadap proses penyembuhan luka insisi pada mencit pengaruh partisipasi anggaran terhadap kepuasan kerja prestasi kerja dengan job relevant information sebagai variabel intervening prediksi erosi pada daerah rawan gerakatanah dengan menggunakan metoda usle kasus jalur lintas bengkulu kepahiang pengaruh gaya kepemimpinan budaya organisasi terhadap kinerja karyawan pt telkom tbk kancatel bengkulu analisis pertumbuhan ekonomi ketimpangan pembangunan antar propinsi sumatera uji mikrobiologis konsentrat laktasi yang mengandung tepung temulawak curcuma xanthoriza roxb dengan lama penyimpanan 2 8 minggu persepsikonsumen terhadap kualitas pelayanan hotel samudera dwinka bengkulu faktor faktor budaya sekolah yang efektif atas prestasi akademik smk negeri 5 kota bengkulu implikasi yuridis pencabutan keterangan terdakwa persidangan terhadap kekuatan pembuktian pengadilan negeri klas i a bengkulu model manajemen sekolah berbasis partisipasi masyarakat memenuhi standar pelayanan minimal spm sarana prasarana smp hidayatullah kota bengkulu tinjauan psikologi kriminal terhadap pengguna sebagai pelaku kejahatan napza kota bengkulu pengaruh penggunaan agregat kasar alam kerikil agregat kasar buatan batu pecah terhadap kuat tekan beton tinjauan terhadap agregat desa sendawar kec semidang alas maras kab seluma penerapan pembelajaran tematik dengan menggunakan pendekatan lingkungan meningkatkan keaktifan prestasi belajar siswa kelas iia sdn 03 kota bengkulu upaya meningkatkan kemampuan berbicara melalui penerapan model pembelajaran debat mata pelajaran bahasa indonesia siswa kelas v b sdn 19 kota bengkulu influence ratio profitability of stock price lq45 kompresi data lossless secara bertingkat dengan algoritma lzw arithmetic coding status hukum perkawinan tidak dicatat kantor urusanagama kua ditinjau dari hukum islam undang undang nomor 1 tahun 1974 analisis hubungan kepuasan kerja kemampuan diri pengalaman kerja dengan semangat kerja pegawai sekretariat propinsi bengkulu kajian terhadap sistem penjaminan mutu sekolah tinggi keguruan ilmu pendidikan persatuan guru republik indonesia lubuklinggau fakultas keguruan ilmu pendidikan universitas bengkulu pengaruh kemampuan motivasi keterampilan terhadap kinerja karyawan kantor badan pertanahan nasional bpn kota bengkulu analisis perbedaan kinerja keuangan bank syariah dengan bank konvensional manajemen kesiswaan perbandingan antara sekolah menengah pertama negeri 1 sekolah menengah pertama negeri 3 padang jaya analisis korelasi kinerja keuangan perusahaan dengan harga saham kasus bank mandiri tbk agustri hestiana 2009 partisipasi masyarakat program pemberdayaan penanggulangan kemiskinan kasus pnpm p2kp desa batu kuning tebat kubu kabupaten bengkulu selatan peranan pendamping kelompok usaha bersama kube pemberdayaan fakir miskin komparatif kube welas asih desa tangsi duren kube bina tani kelurahan tangsi baru kecamatan kabawetan kabupaten kepahiang analisis pertumbuhan ekonomi keunggulan kompetitif sektoral kabupaten seluma persepsi konsumen ditinjau dari keluarga kelas sosial budaya terhadap keputusan pembelian konsumen pada barang elektronik merek sharp pusat pusat penjualan barang elektronik kota bengkulu keputusan pembelian konsumen berdasarkan karakteristik merek telepon selular kasus pada mahasiswa universitas bengkulu fakultas ekonomi program ekstensi pengaruh kedalaman gambut terhadap beberapa sifat kimia tanah tandan buah segar kelapa sawit diajukan menempuh ujian memenuhi persyaratan guna mencapai gelar sarjana hukum kajian terhadap keterlibatan guru bahasa inggris pelaksanaan tugas tambahan mengajar luar sekolah dampaknya terhadap pelaksanaan tugas utama sekolah deskriptif kualitatif sma negeri kota lubuklinggau the kesulitan yang dihadapi oleh mahasiswa menggunakan struktur paralel tulisan bahasa inggris komposisi keenam semester of the english departmentstudents bengkulu universitas 2008 2009 tahun ajaran penerapan rapat rutin terjadwal meningkatkan mutu pembelajaran smp negeri 9 lubuklinggau pengaruh kompensasi lingkungan kerja administrasi terhadap motivasi kerja pegawai pada bagian umum protokol setda kota bengkulu pertumbuhan hasil tiga varietas padi sawah pada berbagai umur pindah tanam analisis peningkatan kualitas produk jasa transportasi berbasis keinginan pelanggan pada po san bengkulu kelas eksekutif tanggungjawab rumah sakit jiwa ketergantungan obat rsjko pelayanan medik provinsi bengkulu pengaruh attractiveness trustworthiness celebrity endorser terhadap keputusan konsumen menggunakan sabun mandi kecantikan kawasan unib belakang unib depan rawa makmur pungsi pengawasan dewan perwakilan rakyat daerah pelaksanaan pemilhan kepala daerah secara langsug kombinasi bokasi tusuk konde wedelia trilobata urea pada cabai merah analisis kinerja keuangan daerah kabupaten kaur kesesuaian lahan budidaya tanaman jagung kecamatan selebar kota bengkulu analisis produktivitas usahatani kelapa sawit desa rawasari kecamatan seluma timur kabupaten seluma propinsi bengkulu analisis kontribusi prospek sektor perdagangan hotel restoran kota bengkulu kajian histologi perkembangan area deposisi resin gaharu akibat infeksi cendawan fusarium sp pada jaringan batang aquilaria malaccensis lamk upaya penegakan hukum pidana terhadap perambah hutan lindung taman nasional kerinci seblat kecamatan rimbo pengadang kabupaten lebong perbandingan hasil belajar kimia siswa antara pembelajaran yang menggunakan media kartu unsur dengan yang tanpa menggunakan kartu unsur pada pokok bahasan sistem periodik unsur unsur meningkatkan hasil belajar siswa melalui pendekatan pembelajaran matematika realistik dengan tipe diskusi th in k pair s h a r e pokok bahasan kubus balok kelas viii b smpn 22 kota bengkulu manajemen bengkel perbandingan antara cacat sekolah kota bengkulu cacat sekolah 25 argamakmur kota efektifitas bahan ajar bahasa indonesia berbasis materi islam kelas iv min pondok kubang pertumbuhan hasil padi gogo pada perlakuan tithonia diversifolia sebagai pensubstitusi n sintetik jarak tanam pengaruh modifikasi bahan baku terhadap mutu es krim penentuan tebal optimal zeolit alam menjernihkan air gambut dengan metode kolom produksi jenis ikan hasil tangkapan yang daratkan pelabuhan pulau baai propinsi bengkulu pengaruh kecepatan waktu sentrifugasi pada proses pemisahan hasil ekstrak teripang pasir holothuria scabra sebagai sumber testosteron antigen pengembangan sistem multimedia pembelajaran matematika berbasis web penerapan pembelajaran genius learning strategy upaya meningkatkan hasil belajar matematika kelas vii smp negeri 1 pondok kelapa analisis pengaruh earning per share dividend per share return on asset current ratio total asset turnover debt equity ratio terhadap harga saham analisis penggunaan pasir kota bengkulu terhadap nilai kuat tekan beton pengujian empiris market timing theory of capital structure bursa efek indonesia dengan kasus ipo emiten non keuangan perbedaan persepsi konsumen terhadap produk rekaman cakram asli bajakan kota bengkulu analisis proses pelaksanaan sertifikasi guru dinas pendidikan nasional kota bengkulu proses penyelesaian sengketa hak utama atas tanah menurut hukum adat rejang kecamatan rimbo pengadang kabupaten lebong persepsi konsumen mengenai keamanan kosmetik respon pertumbuhan semai jati putih gmelina arborea roxb terhadap perbedaan komposisi media tanam serbuk gergaji humanure sekam padi subsoil ultisol analisis faktor faktor pertimbangan pembelian sepeda motor merek yamaha kota bengkulu pengaruh konservasi lahan terhadap perubahan debit sub das rindu hati taba penanjung bengkulu tengah penyelesaian kredit bermasalah terhadap perjanjian kredit antara debitur dengan bank rakyat indonesia cabang arga makmur analisis implementasi kebijakan penataan bangunan kota bengkulu kasus penataan bangunan disepanjang jalan adam malik kota bengkulu analisis perencanaan pada program keaksaraan fungsional pkbm harapan jaya kabupaten kepahiang the reform agenda in riau decentralisation and its consequences akses 6 1 118 130 1693 8356 analisis pengaruh struktur modal return on assets terhadap nilai industri perbankan yang listed bursa efek indonesia kajian peggunaan berbagai jenis biobriket sebagai alternatif pengganti minyak tanah rumah tangga faktor faktor penyebab perkawinan yang tidak dicatatkan pada pegawai pencatat nikah ppn kecamatan lintang kanan kabupaten empat lawang penerapan pembelajaran inquiri terpimpin pembelajaran fisika pada konsep optika geometri alat alat optik meningkatkan hasil belajar siswa pada kelas x sma negeri 8 kota bengkulu classroom action research 4 analisis kesalahan mundur pada penyelesaian sistem persamaan linier kondisi buruk ill conditions upaya peningkatan hasil belajar siswa dengan menerapkan model reciprocal teaching pada konsep gelombang elektromagnetik kelas xe sma negeri 2 kota bengkulu pengaruh teknik penanganan bibit lama penyimpanan terhadap pertumbuhan awal suren toona sure ni merr potensi efesiensi efektivitas pugutan pajak kendaraan bermotor pada dinas pendapatan daerah propisi bengkulu analisa persediaan bahan baku guna meningkatkan efisiensi biaya bahan baku metode branch and bound penjadwalan kerja analisis yuridis dasar pertimbangan putusan hakim no 0339 pdtg 2008 pabn perkara perceraian karena salah satu pihak mendapat penyakit dengan akibat tidak dapat menjalankan kewajiban sebagai isteri analysis of using sleep land to increase food production in creating defense food at bengkulu city kualitas layanan giant supermarket bengkulu terhadap kepuasan pelanggan perilaku plagiat mahasiswa kasus plagiasi melalui internet dikalangan mahasiswa fisipol unib analisis peramalan harga penjualan lobster kasus pada ud samudera koto pengaruh perbedaan suhu ekstraksi daun katuk sauropus androgynus sebagai pengganti topmix terhadap penimbunan lemak berat organ ayam broiler ektrinsik terhadap keputusan pembelian produk elektronik sharp kota bengkulu perbandingan hasil belajar siswa antara pembelajaran yang menggunakan lks berstruktur dengan pembelajaran yang menggunakan lks tak berstruktur kelas vii smp serunting 1 kota bengkulu kinerja guru bahasa indonesia kelas empat iv melaksanakan pembelajaran kontekstual pada sekolah dasar sd kecamatan kedurang ilir kabupaten bengkulu selatan pertumbuhan tanaman kayu bambang lanang madhuca aspera hjlam lahan miring pengaruh aset total dana pihak ketiga pendapatan non bunga ekuitas terhadap laba bersih kasus pt bank bengkulu pengaruh pemupukan n k terhadap serapan n k pertumbuhan kentang hitam pada ultisol faktor faktor yang mempengaruhi struktur modal pada perusahaan lq 45 bursa efek indonesia periode tahun 2005 2008 peranan sub sektor perikanan mendukung perekonomian kabupaten bengkulu utara faktor faktor penyebab terjadinya perkawinan sirri kelurahan pasar pemiri kecamatan lubuk linggau barat ii kota lubuk linggau analisis hukum islam peraturan perundang undangan perkawinan pengelolaan laboratorium bahasa unit pelayanan bahasa stain bengkulu language laboratory kekayaan jenis mamalia besar bukit ketuyak kawasan hutan lindung bukit daun kabupaten bengkulu tengah analisis pengaruh stres kerja terhadap kinerja perawat rsjko soeprapto daerah bengkulu tahun 2009 analisis fungsi biaya usahatani jagung kabupaten seluma analisis sikap perilaku konsumen terhadap pembelian buah pear ya lie supermarket giant kota bengkulu indentifikasi bakteri pada kepiting bakau stasiun karantina ikan fatmawati bengkulu jenis jenis tumbuhan yang dapat dimanfaatkan sebagai obat gangguan menstruasi oleh penduduk desa darat sawah padang siring kota agung kecamatan seginim kabupaten bengkulu selatan analisa kualitatif resin gaharu aquilaria malaccensis lamk hasil inokulasi alam pada kualitas yang berbeda analisis faktor faktor yang mempengaruhi permintaan perumahan kota bengkulu analisis penggunaan pasir laut sebagai agregat halus terhadap kuat tekan beton penerapan teknik observasi kelas sesuai dengan tipe guru meningkatkan kemampuan mengajar ilmu pengetahuan alam biologi penelitian tindakan sekolah menengah pertama negeri 1 giri mulya kabupaten bengkulu utara analisa pembekuan resin unsaturated polyester berpenguat serat orthocoupus elastica pengaruh jenis waktu pengendalian gulma terhadap pertumbuhan hasil kedelai pengaruh kemampuan kerja ketrampilan budaya kerja terhadap efektivitas kerja pada pegawai dinas perkebunan propinsi bengkulu peningkatan kemampuan menulis karangan siswa kelas v b sd negeri 11 kota bengkulu melalui teknik konferensi pengaruh penggunaan limbah beton sebagai pengganti agregat kasar pada campuran beton performans reproduksi sapi perah fries holland fh kecamatan selupu rejang desa air duku desa air putih kali bandung kabupaten rejang lebong analisis pengendalian mutu produksi udang vannamei pada pt cendana prioritas lestari bengkulu tengah penerapan model pembelajaran kooperatif dengan menggunakan metode snowball throwing upaya meningkatkan hasil belajar metematika siswa kelas ivb sdn 07 kota bengkulu pengaruh faktor faktor keputusan pelanggan telkomsel mengunjungi kembali situs web telkomsel kota bengkulu upaya meningkatkan aktivitas hasil belajar siswa pada materi aljabar kelas vii2 smpn 3 kota bengkulu melalui pembelajaran matematika realistik peningkatan kemampuan menulis puisi melalui kegiatan majalah dinding sebagai portofolio pada siswa kelas viii smp negeri h wukirsari kecamatan tugumulyo kabupaten musi rawas analisis kepuasan konsumen terhadap pelayanan pada pt bank bengkulu capem tais kabupaten seluma peranan ketua kelompok tani mendorong keswadayaan kelompok tani study kasus kelompok tani rindang harapan desa dusun baru 1 kec talang empat kab bengkulu tengah hubungan antara pertumbuhan dengan hasil lima varietas ubi jalar tanah marjinal ultisol yang diberi pupuk hayati cma em4 interpretasi resistivitas bawah permukaan dengan metode geolistrik tahanan jenis mapping memprediksi sebaran panas bumi daerah prospek gunungapi hulu lais bagian utara analisis perilaku pimpinan meningkatkan kedewasaan kerja bawahan lingkungan biro personel polda bengkulu penerapan peta pikiran pembelajaran bahasa indonesia dengan menggunakan pendekatan quantum learning meningkatkan kemampuan menulis paragraf deskripsi siswa kelas v sdn 17 kota bengkulu menentukan harkat permeabilitas tanah batuan daerah aliran sungai serut bengkulu berdasarkan pengukuran dengan metode permeameter tinggi tetap constant head permeability method rancang bangun sistem informasi simpan pinjam koperasi pegawai negeri universitas bengkulu faktor faktor yang mempengaruhi pendapatan usaha ternak sapi perah kecamatan selupu rejang kabupaten rejang lebong study kasus desa kali padang air putih kali bandung pelaksanaan pemberian pembebasan bersyarat rangka pembinaan narapidana propinsi bengkulu upaya meningkatkan pemahaman konsep siswa dengan menggunakan cam concept attainment model kelas vii smpn 1 pondok kelapa pada materi bilangan bulat pengaruh holding time pada proses quench temper terhadap sifat mekanik baja ems 45 interferensi penggunaan bahasa indonesia oleh guru sekolah dasar negeri bengkulu utara peranan balai latihan kerja terhadap penyediaan tenaga kerja bengkulu kajian metode dikotomi sebagai metode optimasi menentukan akar persamaan nonlinier analisis faktor faktor yang mempengaruhi perilaku perpindahan merek kosmetik mahasiswi ekstensi fakultas ekonomi universitas bengkulu pengembangan perangkat pembelajaran matematika smp pada pokok bahasan operasi pecahan dengan menerapkan pendekatan pembelajaran matematika realistik model kooperatif kelas vii smpn 8 kota bengkulu peningkatan keterampilan berbicara dengan penerapan strategi pembelajaran bermain peran kelas akselerasi sekolah dasar negeri 8 kota bengkulu pengaruh budaya kerja kemampuan komitmen organisasi terhadap kinerja pegawai biro pengelolaan keuangan sekretariat daerah provinsi bengkulu peningkatkan hasil belajar apresiasi sastra dengan strategi analisis wacana kritis awk kelas xi sma negeri 2 kota bengkulu pelaksanaan pembebasan bersyarat cuti menjelang bebas cuti bersyarat pada narapidana lembaga pemasyarakatan klas ii a curup penerapan pembelajaran kooperatif tipe numbered heads together nht sebagai upaya peningkatan hasil belajar konsep tekanan kelas viii1 smp negeri 1 kota bengkulu kajian terhadap pengelolaan kurikulum perbandingan diploma iii kebidanan politeknik kesehatan bengkulu dengan diploma iii kebidanan manna bengkulu selatan evaluasi kesesuaian kurikulum berbasis kompetensi pendidikan keaksaraan mata pelajaran menulis dengan pelaksanaannya lapangan kasus pkbm widya kencana desa pasar ujung kabupaten kepahiang restitusi kepada korban mati atau luka berat sebagai syarat pidana bersyarat pada tindak pidana lalu lintas jalan penerapannya pengadilan negeri bengkulu kajian terhadap hasil supervisi pengawas upaya kepala sekolah menindaklanjuti smp negeri kecamatan mukomuko selatan perbandingan pembelajaran matematika menggunakan macromedia flash dengan pembelajaran konvensional kelas xi tik smks 4 pgri kota bengkulu the effects dispositional and situasional cognitive factors on the intention to use internet an empirical study of the acceptance of information technology at universitas bengkulu jurnal ekonomi bisnis indonesia 24 2 177 200 2085 8272 the situational cognitive mediation effects on dispositional personality influence on the intention to use the internet an empirical study of information technology acceptance within higher education institution j analisis kepuasan konsumen atas jasa pelayanan travel pada po bengkulu indah travel bengkulu perbandingan tanggung jawab direksi menurut undang undang nomor 1 tahun 1995 undang undang nomor 40 tahun 2007 tentang perseroan terbatas analisis pengaruh kepemimpinan budaya organisasi komunikasi internal kemampuan individual terhadap kinerja karyawan pt pln ws2jb cabang bengkulu analisis implementasi program perusahaan inti rakyat perkebunan pir bun pada ptpn vii unit sluma kabupaten bengkulu tengah variabel anteseden partisipasi penganggaran yang mempengaruhi kinerja manajerial empiris pada pemerintah daerah kota bengkulu computer self efficacy cse mahasiswa akuntansi penggunaan teknologi informasi tinjauan perspektif gender analisis putusan pengadilan agama kelas 1a bengkulu tentang cerai talak nomor 0246 pdtg 2008 pabn description and identification of quantitative traits of bengkulu local upland rice akta agrosia 12 2 137 146 1410 3354 koleksi identifikasi kultivar padi lokal gogo provinsi bengkulu kesaksian wanita pernikahan analisis komparatif terhadap empat imam madzhab analisis pengaruh economic value added eva return on asset roa return on equity roe terhadap return saham pada perusahaan yang tergabung indeks lq 45 bursa efek indonesia pertumbuhan stek inang rafflesia tetrastigma sp sebagai media pembelajaran biologi smp pada pokok bahasan perkembangbiakan tumbuhan analisis tingkat kualitas pelayanan aplikasi qfd quality function deployment pada hotel vista bengkulu pembelajaran kimia dengan menggunakan teknik probing melalui metode demonstrasi sebagai upaya meningkatkan hasil belajar aktivitas belajar siswa sma negeri 1 lebong atas dampak perceraian orang tua terhadap anak kasus pada remaja kelurahan sidomulyo kecamatan gading cempaka kota bengkulu pelaksanaan penangguhan penahanan terhadap tersangka terdakwa proses peradilan pidana kota bengkulu performans pertumbuhan itik talang benih jantan melalui pemanfaatan limbah ikan teri sebagai sumber protein ransum tinj auan hukum islam tentang wali nikah yang berbeda agam a dengan m emp elai p eremp uan kota bengkulu kekayaan jenis burung bukit ketuyak kawasan hutan lindung bukit daun kecamatan taba penanjung kabupaten bengkulu utara provinsi bengkulu pengelolaan kurikulum tingkat satuan pendidikan ktsp persepsi orang tua terhadap taman penitipan anak sebagai pengganti peran keluarga kasus taman penitipan anak pelita hati kota bengkulu analisis network perencanaan pengawasan penyelesaian proyek dengan metode jalur kritis pada pt jembatan emas sejahtera pemanfaatan limbah serbuk besi sebagai bahan pengganti sejumlah agregat halus pada campuran asphalt concrete binder course ac bc pengaruh gaya kepemimpinan lingkungan kerja promosi jabatan terhadap kinerja karyawan bank central asia cabang bengkulu manajemen perawatan sarana pendidikan komparatif kualitatif smp negeri 11 smp negeri 2 lubuklinggau pengaruh kecemasan tingkat kualitas respon siswa tentangpermasalahan matematika berbasis taksonomi solo pembelajaran kooperatif tipe stad terhadap hasil belajar matematika kelas x sman 3 kota bengkulu persepsi pegawai terhadap tingkat konflik lingkungan kerja kinerja pegawai balai labkesda provinsi bengkulu efektivitas pengelolaan program pendidikan kecakapan hidup pada pendidikan non formal meningkatkan aktivitas hasil belajar matematika siswa melalui pembelajaran connected mathematics project dengan menggunakan hands on activity smp negeri 13 kota bengkulu faktor faktor yang mempengaruhi return saham pada perusahaan manufaktur bursa efek indonesia suatu analisis fundamental risiko sistematik penerapan teknik kunjungan kelas terjadwal oleh kepala sekolah meningkatkan kinerja guru melaksanakan pembelajaran matematika penelitian tindakan smp negeri megang sakti kabupaten musi rawas investasi wakaf tunai perspektif hukum islam undang undang nomor 41 tahun 2004 tentang wakaf rancang bangun sistem pengendali pintu otomatis menggunakan personal komputer perlindungan hak konstitusional perempuan pemilihan umum legislatif menurut undang undang nomor 10 tahun 2008 evaluasi manajemen pendidikan sistem ganda sekolah menengah kejuruan negeri 3 kota lubuklinggau rancang bangun aplikasi sistem deteksi pengenalan wajah berdasarkan algoritma haar eigenface rancang bangun sistem informasi perpustakaan politeknik kesehatan bengkulu menggunakan oracle penerapan metode simulasi meningkatkan prestasi belajar siswa pada mata pelajaran pkn kelas ivb sd negeri 65 kota bengkulu implementasi standar operasional prosedur tindakan keperawatan deskriptif kualitatif rumah sakit umum daerah dr m yunus bengkulu corrletation analysis of supervision affecting and organization culture individual performance junior accounting at public accaunting office with job satisfaction is intervening variable upaya pengelola taman bacaan masyarakat tbm pustaka rakyat memelihara kemelekaksaraan warga keaksaran fungsional rekayasa lingkungan tumbuh kopi arabika unggul pada dataran rendah berdasarkan aktifitas nitrat reduktase project report lembaga penelitian universitas bengkulu unpublished penampilan morfologi isoenzym peroksidase kopi arabika dataran rendah akta agrosia 12 1 15 20 1410 3354 laporan penelitian unggulan madu lebah bunga kopi robusta produk universitas bengkulu bahan naungan stup rekayasa kemasan cantik madu unib project report lembaga penelitian universitas bengkulu bengkulu low temperature hydrothermal synthesis of calcium phosphate ceramics effect of excess ca precursor on phase behavior indian journal of chemistry 48 11 1492 1500 0376 4710 persepsi wajib pajak orang pribadi terhadap sistem monitoring pelaporan pembayaran pajak mp3 pada kpp kota bengkulu perlindungan terhadap korban penganiayaan proses peradilan pidana wilayah hukum lubuk linggau analisis perubahan pengelolaan keuangan rsud dr m yunus bengkulu dari swadana menjadi badan layanan umum daerah blud pengorganisasian pelaksanaan pendidikan pelatihan badan pendidikan pelatihan provinsi bengkulu analisis kinerja seksi hak tanah pendaftaran tanah pada kantor pertanahan kabupaten rejang lebong pengaruh suhu lama waktu terhadap ekstraksi refluks teripang pasir holothuria scabra sebagai sumber steroid antigen upaya meningkatkan hasil belajar matematika siswa madrasah tsanawiyah pesantren al hasanah kabupaten bengkulu tengah dengan pengajaran remedial menggunakan media lembar kerja siswa lks teknik penentuan fungsi dengan menggunakan interpolasi polinomial pengaruh indikator krisis keuangan global terhadap indeks harga saham gabungan ihsg bursa efek indonesia perbandingan poligami menurut hukum islam perundang undangan indonesia pemahaman aparatur pemerintah kota bengkulu penerapan akuntansi keuangan daerah menuju terciptanya good governance pertanggungjawaban pidana tindak pidana penebangan kayu ilegal illegal logging penerapan pendekatan quantum learning dengan metode bermain meningkatkan motivasi hasil belajar biologi siswa kelas x sman 1 curup timur kajian kualitas kerupuk kijing jaboy pseudodon vandenbushianus menggunakan konsentrasi daging kijing telur ayam hubungan berat tandam buah segar kelapa sawit dengan ca mg ktk tanah pada ultisol bengkulu akta agrosia 12 2 173 176 1410 3354 analisis pertanyaan lisan bahasa inggris guru standar internasional kelas sman 2 kota bengkulu pada guru bahasa inggris first grade international standard kelas tahun akademik 2009 2010 meningkatkan aktivitas hasil belajar kimia siswa melalui penerapan model pembelajaran kooperatif tipe kepala bernomor terstruktur pada pokok bahasan reaksi reduksi oksidasi kelas xd sma n 6 kota bengkulu cara belajar siswa yang berprestasi rendah pada pembelajaran ipa biologi berbasis masalah lesson study kelas viiic smpn 9 kota bengkulu analisis pengaruh kompensasi pengetahuan keterampilan terhadap kinerja karyawan industri kecil pakaian jadi kota bengkulu persepsi orang tua terhadap peranan taman penitipan anak meningkatkan kemampuan penyesuaian diri anak analisis penyerapan tenaga kerja sektor industri pengolahan indonesia pengendalian aphis craccivora koch pada kacang panjang dengan ekstrak kasar rimpang kunyit curcuma domestica val biji makasar brucea javanica l syelfi anita perbandingan hak waris janda menurut hukum islam hukum adat serawai desa gunung kembang kecamatan semidang alas maras inventarisasi burung air yang berpotensi sebagai vektor avian influenza virus kota bengkulu perbandingan hasil belajar matematika siswa antara model pembelajaran active learning menggunakan teknik sepak bola verbal dengan pembelajaran konvensional kelas vii smpn 13 kota bengkulu kelimpahan dinamika populasi odonata berdasarkan hubungannya dengan fenologi padi beberapa persawahan sekitar bandung jawa barat exacta 7 2 69 75 1412 3617 efektivitas komunikasi antarpribadi petugas pemasyarakatan dengan warga binaan mengubah mental warga binaan kasus lembaga pemasyarakatan kelas ii a curup prop bengkulu kebijakan penyehatan organisasi perguruan tinggi universitas bengkulu triadik 12 2 60 79 8053 8301 the english students perceptions toward the psychological atmosphere in teaching and learning processes dampak program kf terhadap ketuntasan pemberantasan buta aksara kualitatif desa pondok kelapa kecamatan pondok kelapa kabupaten bengkulu tengah kajian pemanfaatan fraksi berat hasil firolisis cangkang sawit tar sebagai perekat proses pembuatan briket arang cangkang sawit analisis pendapatan penetapan harga minimum usaha perkebunan kelapa sawit rakyat desa rawasari kecamatan seluma timur provinsi bengkulu implementasi algoritma genetika pada optimasi produksi perusahaan roti perilaku perambahan hutan oleh komunitas tepian hutan yang mengalami pergeseran sistem perekonomian pengaruh gaya kepemimpinan transformasionalterhadap kualitas kehidupan kerja komitmen organisasional pada cv ppmi tri mandiri bengkulu penerapan pembelajaran connected mathematics project cmp dengan teknik think pair share tps meningkatkan hasil belajar matematika siswa smpn 17 kota bengkulu peranan nadzir pengelolaan pengembangan tanah wakaf setelah berlakunya undang undang nomor 41 tahun 2004 tentang wakaf kecamatan muara bangkahulu upaya meningkatkan minat baca siswa pada mata pelajaran bahasa indonesia melalui pemberian umpan balik penguatan kelas v sd negeri 17 kota bengkulu metode palayanan sosial anak jalanan melalui rumah singgah kasus pada rumah singgah sangbaja tanjung karang bandar lampung preferensi cacing tanah lokal pheretima sp terhadap beberapa macam media pemeliharaan performance of soybean pod borer etiella zinckenella treitschke lepidoptera pyralidae and host preference on soybean and groundnut akta agrosia 12 1 62 67 1410 3354 hukuman penjara sebagai alasan perceraian menurut hukum islam undang undang nomor 1 tahun 1974 prosesi bercocok tanam ladang menurut hukum adat rejang kecamatan rimbo pengadang kabupaten lebong fungsi komite sekolah meningkatkan mutu pendidikan pertumbuhan awal surian toona sureni merr dengan berbagai tinggi bibit berbagai variasi lubang tanam praktik perjanjian bagi hasil tanaman padi pada tanah sawah menurut hukum adat tungkal desa tungkal kecamatan pino raya kabupaten bengkulu selatan pengaruh ambiguitas peran konflik peran terhadap kepuasan kerja pegawai lingkungan dinas pendapatan pengelolaan keuangan aset daerah pemerintah kota bengkulu korelasi antara servicescape dengan image perguruan tinggi penerapan model pembelajaran kooperatif tipe tgt teams games tournamet pembelajaran biologi sebagai upaya memperbaiki proses hasil belajar biologi siswa kelas viiic smpn 2 kota bengkulu analisis implementasi kebijakan penyaluran pupuk bersubsidi kelurahan kandang limun kecamatan muara bangkahulu kota bengkulu perbandingan hasil belajar siswa yang diajar dengan model advance organizer yang diajar dengan pembelajaran konvensional smp negeri 20 kelas viii kota bengkulu pengaruh stres kerja terhadap kinerja karyawan pt federal international finance cabang bengkulu hubungan pembinaan disiplin dengan tingkat disiplin kerja pegawai dinas koperasi pengusaha kecil menengah propinsi bengkulu pengaruh pemberian pakan kroto rang rang oerophylla smaragdina pakan jangkrik brachytrypes membranaceus pakan campuran terhadap daya tahan hidup anak walet putih perbedaan hasil belajar siswa menggunakan metode praktikum tugas resep dengan praktikum berbasis media chemslab pada pokok bahasan stoikiometri larutan kelas xi ipa sma negeri 8 kota bengkulu corn productivity increasing iin ultisol upland by using sawdust fermented akta agrosia 12 2 124 129 1410 3354 titik impas keuntungan usaha ternak sapi perah kecamatan selupu rejang kabupaten rejang lebong upaya peningkatan prestasi belajar membaca melalui penerapan pendekatan keterampilan proses pada siswa kelas iv sd negeri 65 kota bengkulu pengaruh pendidikan pengalaman kemampuan disiplin kerja kompensasi lingkungan kerja terhadap prestasi kerja pegawai dinas kebudayaan pariwisata perhubungan kabupaten kepahiang analisis fundamental sistem du pont economic value added eva rangka evaluasi kinerja keuanganpada perusahaan retail yang listed bursa efek indonesia analisis solusi optimal persoalan rute terpendek menggunakan algoritma genetika berbasis mutasi biner kasus network jalan raya kota bengkulu implementation of 5e learning cycle to increase students inquiry skills and biology understanding triadik 12 1 45 55 8053 8301 penerapan model pembelajaran kooperatif tipe group investigation dengan media microsoft power point meningkatkan hasil belajar siswa pada konsep usaha energi kelas xi ipa 1 man model kota bengkulu evaluasi keberhasilan tanaman program gerakan nasional rehabilitasi hutan lahan gnrhl penanaman pola swadaya desa arga indah kabupaten bengkulu tengah penerapan pendekatan open ended sebagai upaya meningkatkan hasil belajar siswa pada pembelajaran matematika kelas v sd negeri 13 babatan seluma penelusuran miskonsepsi tentang prisma limas pada siswa kelas viiia smp negeri 10 kota bengkulu analisis kadar kalsium ca tulang embrio puyuh coturnix coturnix japonica pada beberapa tahapan umur inkubasi setelah penambahan tepung kerabang telur puyuh pada pakan penggunaan bahasa indonesia oleh guru sekolah dasar kabupaten kaur upaya meningkatkan aktivitas hasil belajar siswa melalui model cooperative type team games tournament tgt dengan pemanfaatan animasi kimia komputasi kelas xf sma negeri 2 kota bengkulu meningkatkan hasil belajar kimi keaktifan siswa melalui pembelajaran kooperatif tipe two stay two stray meningkatkan hasil belajar kimia keaktifan siswa melalui pembelajaran kooperatif tipe two stay two stray dua tinggal dua tamu efektivitas pemungutan retribusi izin usaha jasa hiburan oleh dinas pariwisata kebudayaan kota bengkulu uji pendahuluan penentuan adanya kandungan senyawa flavonoid triterpenoid pada sayuran serta bioassay brine shrimp menggunakan artemia salina leach upaya peningkatan hasil belajar aktivitas siswa pembelajaran pkn melalui model kooperatif tipe stad student teams achievement divisions kelas v sdn 65 kota bengkulu pengelolaan kesiswaan peningkatan prestasi belajar sekolah menengah kejuruan negeri 1 lubuklinggau unjuk kerja sistem pengukur intensitas cahaya berbasis telemetri persepsi politik mahasiswa fisip unib terhadap citra parpol baru pemilu 2009 partai gerindra partai hanura pertimbangan majelis hakim memutus perkara gugatan hak asuh anak pengadilan agama kelas i a bengkulu peningkatan produktivitas padi sawah dengan perbaikan teknologi budidaya akta agrosia 12 2 212 218 1410 3354 hubungan persepsi mahasiswa atas pelaksanaan tutorial tatap muka terhadap kualitas hasil belajar mahasiswa program pendas masa ujian 20081 upbjj universitas terbuka bengkulu triadik 12 2 109 122 8053 8301 pendugaan parameter regresi berdasarkan sebaran t student gradien 5 2 489 493 0216 2393 analisis lingkungan perusahaan persaingan formulasi strategi pemasaran jasa konsultansi pt yodya karya persero faktor faktor yang mempengaruhi kesiapan sumber daya aparatur keuangan menghadapi implementasi sistem akuntansi keuangan daerah kota bengkulu manajemen rumah ibadah sebagai pusat pembinaan umat deskriptif kualitatif masjid al furqan kebun dahri gereja styohanes kota bengkulu penentuan struktur kedalaman lapisan batuan bawah permukaan rusunawa dengan menggunakan metode geolistrik tahanan jenis self potensial analisis pemotivasian rektor pada pegawai biro administrasi umum keuangan universitas bengkulu pengelolaan harta warisan yang tidak terurus akibat penolakan ahli waris menurut hukum perdata persepsi mahasiswa dosen akuntansi kota bengkulu terhadap kode etik akuntan pemerintah kode etik bpk ri analysis devlopment of seblat elephants training center case study in selat elephants training center pengaruh nilai slump terhadap kuat tekan beton kajian penggunaan zeolit alam menurunkan tingkat pencemar limbah cair pengolahan pulp this research purpose is to know the influence of government advenditure investment and inflation in unemployment in province of bengkulu rhizobium and amf increase growth and yield of three soybean genotipes in ultisols akta agrosia 12 1 68 74 1410 3354 rhizobium cma meningkatkan pertumbuhan hasil tiga genotipe kedelai ultisols akta agrosia 12 1 68 74 1410 3354 dampak inokulasi ganda cendawan mikoriza arbuskula rhizobium indigenous pada tiga genotipe kedelai tanah ultisol akta agrosia 12 2 155 166 1410 3354 double inoculation of indigenous arbuscular mycorrhizal fungi and rhizobium impact on three soybean genotypes in ultisol akta agrosia 12 2 155 166 1410 3354 faktor faktor yang berhubungan dengan tingkat partisipasi anggota koperasi lepp m3 kota manna kabupaten bengkulu selatan analisa pengaruh semburan air laut terhadap laju korosi pada sambungan baja aluminium tembaga zyco bm 2010 pengaruh orang tua perokok teman sepermainan iklan rokok terhadap perokok siswa smp pada siswa smp n 2 tebat karai kabupaten kepahiang patogenisitas steinernema spp isolat bengkulu terhadap spodoptera exigua hubn yang menyerang bawang daun analisis z skor penilaian kinerja keuangan serta pengaruhnya terhadap harga saham perusahaan manufaktur bej model kerja kelompok guru better education through reformed analisis vegetasi tumbuhan bawah tegakan muda jati putih gmelina arborea roxb umur 1 5 tahun lahan reklamasi bekas tambang batubara pt danau mas hitam kec taba penanjung kab bengkulu utara identifikasi faktor penyebab orang tua anak usia dini desa embong panjang kecamatan lebong tengah tidak memasukkan anaknya pada lembaga pendidikan anak usia dini pengelolaan penilaian hasil belajar siswa sma plus negeri 7 kota bengkulu pola kepemimpinan pondok pesantren al qur an harsallakum kota bengkulu mewujudkan kualitas pendidikan identifikasi karakteristik lahan rawan longsor kawasan hutan lindung bukit daun kabupaten kepahyang heteroskedastisitas regresi linier sederhana n tindak pidana penadahan hubungannya dengan tindak pidana pencurian kendaraan bermotor curanmor kota bengkulu laporan penelitian kajian ketahanan pangan masyarakat pesisir pulau enggano efeknya terhadap kesejahteraan pijakan strategi pembangunan pulau kecil terluar project report lembaga penelitian universitas bengkulu bengkulu faktor factor yang berhubungan dengan partisipasi anggota pengembangan kelompok tani kelurahan kandang limun kota bengkulu penetapan calon anggota dprd kabupaten kota berdasarkan undang undang nomor 12 tahun 2003 undang undang nomor 10 tahun 2008 tentang pemilihan umum anggota dpr dpd dprd pengaruh kebijakan dividen terhadap harga saham pada perusahaan yang tergabung lq 45 bursa efek indonesia uji efektivitas ekstrak rimpang lengkuas merah alpinia purpurata kschum sebagai antibakteri escherichia coli penyebab diare upaya meningkatkan hasil belajar kimia siswa kelas x3 sman 2 bengkulu selatan melalui model discovery learning metode brainstorming menggunakan media powerpoint pada pokok bahasan minyak bumi gas alam upaya pendidik penanaman budi pekerti bagi peserta didik pada kelompok bermain paud pelita hati kota bengkulu alternatif pidana perampasan kemerdekaan non custodial sanction pembaharuan hukum pidana indonesia respon pertumbuhan hasil ubi jalar terhadap beberapa jenis bokashi dosis pupuk n analysis of agriculture superior commodity in north bengkulu regency beberapa masalah hukum tentang wasiat konteks peradilan agama kutei 17 1 17 1412 9639 etika bisnis menurut hukum islam suatu kajian normatif supremasi hukum 17 1 17 30 1693 766x pengaruh penambahan ekstrak akar alang alang imperata cylindrica ransum terhadap performans ayam broiler the analisis of the capitaly of the regional government s finance in carrying out the regional loan the mukomuko case study of the regency regional government pengaruh pengapuran pupuk kandang terhadap peningkatan ca mg pertumbuhan lamtoro pada tanah bekas tambang batubara status harta warisan akibat ahli waris murtad ditinjau dari hukum islam hukum perdata barat bw hukum adat pengelolaan delapan standar nasional pendidikan komparatif antara sekolah dasar negeri 22 argamakmur dengan sekolah dasar negeri 13 padang jaya penerapan model pembelajaran kooperatif tipe jigsaw ii meningkatkan hasil belajar matematika siswa pada pokok bahasan bangun datar segi empat kelas vii smp n 9 kota bengkulu perlindungan terhadap lanjut usia balai pelayanan penyantunan lansia pagar dewa bengkulu menurut undang undang nomor 13 tahun 1998 tentang kesejahteraan lanjut usia ditinjau menurut hukum islam penuntasan wajib belajar pendidikan dasar sembilan tahun kecenderungan mahasiswa menggunakan koleksi bahan pustaka upt perpustakaan universitas bengkulu "jurnal kepustakawanan masyarakat membaca" diterbitkan oleh upt perpustakaan universitas sriwijaya 25 1 11 32 0216 7808 peranan lembaga penjaminan mutu pendidikan meningkatkan mutu guru kota bengkulu korelasi antara pertumbuhan hasil cabai pada pengurangan dosis urea yang disubstitusikan bokasi tusuk konde wedelia trilobata implikatur percakapan siswa sltpn 17 kota bengkulu analisis teknik finansial pembuatan briket cangkang kelapa sawit tanpa pengarangan dengan bahan pemicu serbuk batubara dampak keberhasilan lulusan kursus menjahit peningkatan status sosial taraf ekonomi pengembangan bahan ajar sastraberbasis sastra koran efektivitas komik cerpen sebagai media komunikasi meningkatkan pengetahuan anak mengenai penanggulangan penyakit demam berdarah peningkatan kualitas pembelajaran dengan menerapkan pendekatan paikem pada mata pelajaran ips siswa kelas v sdn 04 pondok suguh melalui metode pemecahan masalah analisis implementasi akuntabilitas transparansi penganggaran kabupaten mukomuko analisis hubungan perubahan organisasi dengan kinerja karyawan dinas pemuda olahraga dispora propinsi bengkulu pemanfaatan sumber belajar oleh guru bahasa indonesia smp negeri 15 kota bengkulu tahun ajaran 2008 2009 upaya penyelesaian kredit bermasalah pada bank tabungan negara cabang bengkulu analisis faktor faktor yang mempengaruhi penerimaan pajak kendaraan bermotor provinsi bengkulu pendekatan sistem pemilihan industri hilir unggulan berbasis kopi propinsi bengkulu in semirata bks ptn indonesia wilayah barat th 2009 unpublished peningkatan pemahaman siswa terhadap isi teks sastra daerah melalui model pembelajaran kooperatif tipe stad kelas vii a smp negeri 5 seluma hubungan penempatan pegawai dengan prestasi kerja pegawai bappeda pada pegawai kantor badan perencanaan pembangunan daerah propinsi bengkulu upaya meningkatkan hasil belajar keaktifan siswa kelas xi ipa ii sma negeri 4 kota bengkulu melalui model pembelajaran aptitude treatment interaction dengan pengajaran team teaching perbandingan hasil belajar respon siswa menyelesaikan soal soal persamaan kuadrat dengan cara melengkapkan kuadrat sempurna dengan rumus abc kelas x smk negeri 1 kota bengkulu peningkatan hasil belajar bahasa indonesia kelas iii sd negeri 3 kota bengkulu melalui pembelajaran tematik ketahanan pangan rumah tangga nelayan faktor determinannya kasus tiga desa kabupaten mukomuko provinsi bengkulu sikap mahasiswa terhadap pusat belajar mandiri self access centre universitas bengkulu triadik 12 1 17 23 8053 8301 analisis upaya peningkatan pendapatan rumah tangga nelayan upaya meningkatkan aktivitas hasil belajar siswa pada konsep tekanan dengan penerapan model pencapaian konsep cam kelas viii a smpn 1 rimbo pengadang kabupaten lebong aplikasi speech recognition pembuka apikasi komputer dengan java peningkatan kemampuan guru pembelajaran pkn dengan pendekatan pendidikan nilai yang inovatif triadik 12 1 57 61 8053 8301 inventarisasi sanksi delik adat hukum adat pekal kecamatan ketahun kabupaten bengkulu utara upaya peningkatan hasil belajar matematika siswa dengan penerapan model pembelajaran investigasi kelompok mpik pada kelas v sd negeri 09 lebong selatan kabupaten lebong respon konsumen terhadap minuman berenergi merek kuku bima bengkulu partisipasi stakeholders kota bengkulu pembuatan peraturan daerah kasus proses penyusunan perda no 3 tahun 2008 tentang ketentraman ketertiban umum wilayah kota bengkulu analisis permintaan terhadap jasa transportasi udara propinsi bengkulu penyelesaian perkara pidana adat cicil mulut pada lembaga adat pekal kecamatan putrid hijau bengkulu utara pengaruh struktur modal terhadap kinerja keuangan perusahaan sektor industri makanan minuman yang terdaftar bei penggunaan arang aktif dari tempurung kelapa menghilangkan warna kuning proses pembuatan es balok analisis kompetensi aparatur bappeda kabupaten kepahiang pelaksanaan tugas fungsinya prosedur pelaksanaan perkawinan poligami bagi pegawai negeri sipil kota bengkulu ditinjau dari peraturan pemerintah nomor 10 tahun 1983 upaya peningkatan hasil belajar siswa menggunakan model clis children s learning in science pada konsep cahaya kelas viii e smpn 5 kota bengkulu analisis pelaksanaan program desa siaga kecamatan lubuk sandi kabupaten seluma karakteristik suara anak itik umur sehari day old duckling berdasarkan pengolahan sinyal digital sebagai pendugaan jenis kelamin sexing penggunaan alat peraga peningkatan kualitas pembelajaran tematik kelas iii sd negeri 65 kota bengkulu sistem upah perempuan pekerja penyapu jalan kasus pada perempuan penyapu jalan kota bengkulu konflik manusia gajah elephas maximus sumatranus temminck 1847 pada area perkebunan perladangan masyarakat desa sidodadi desa tunggang desa dusun pulau desa sukabaru kabupaten mukomuko bengkulu utara provinsi bengkulu implementasi budaya keselamatan kesehatan kerja pencegahan kecelakaan kerja perlakuan salah penelantaran orang tua pada anak menjadi penyebab anak delinkuen kota bengkulu keaneka ragaman jenis rotan kawasan hutan danau gunung tujuh taman nasional kerinci seblat kabupaten kerinci propinsi jambi sistem penggajian pada pt varia intra vinance pemanfaatan kitosan dari limbah cangkang kepiting ranjungan portunus pelagicus sebagai adsorben menyerap ion logam merkuri hg air efektivitas pelaksanaan perda no10 tahun 2002 tentang retribusi surat izin tempat usaha pada bagian perekonomian sekretariat daerah pemerintah kota bengkulu pemberlakuan standar sertifikasi terhadap mandor tukang kota bengkulu the study of transesterifications reaktion of moringa oleifera lamk seeds oil catalized by sulfuric acid and potassium hydroxide pengetahuan persepsi siswa sekolah dasar kecamatan lebong utara kabupaten lebong terhadap keberadaan taman nasional kerinci sebelat tnks pengaruh ukuran perusahaan persentase saham yang ditawarkan ke masyarakat profitabilitas roe terhadap underpricing pada penawaran saham perdana ipo kasus pada perusahaan yang terdaftar bej tahun 2004 2007 orientasi gaya hidup konsumtif remaja kota bengkulu terhadap niat beli produk distro distribution outlet analisis penggunaan pasir laut sebagai agregat halus terhadap kuat tekan beton students preferred out of class activities in learning english a study at the second year students of international classes of sman 2 kota bengkulu in academic year of 2008 2009 pengaruh metode pembelajaran kooperatif terhadap hasil belajar membaca cepat siswa kelas x sman 1 curup analisis korelasi antara indikator indikator kinerja pundamental harga saham kasus bank sentral asia kajian penentuan fungsi polinomial dengan metode ortogonal polinomial taraf kuantitatif berjarak sama kajian sedimentasi alur pelayaran pelabuhan pulau baai bengkulu penera apan str m pembe meningk m rategi k elajara katkan haman pa negeri 6 pemah sd n know wan an baha kemam ada sisw 65 kota nt to know sa indo puan me wa kel bengku w learned onesia u embaca las ivb ulu d kwl ntuk a pemindahan pemakaman umum yang terkena proyek multi years ditinjau dari hukum islam kasus kelurahan tengah padang kota bengkulu pola komunikasi politik partai demokrat provinsi bengkulu kajian tingkat pengembalian krdit faktor faktor yang mempengaruhinya pengaruh motivasi budaya kerja terhadap kinerja pegawai akademi keperawatan provinsi bengkulu analisis kebijakan dividen pengujian dividend signaling thoery rent extraction hypotesis penerapan pendekatan kontruktivisme melalui siklus belajar 5e pada pokok bahasan sistem koloid sebagai upaya meningkatkan hasil belajar siswa kelas xi ipa man 1 kepahiang degradasi asam 2 4 diklorofenoksiasetat 2 4 d pestisida santamin 865 sl secara fotolisis sonolisis dengan penambahan katalis tio anatase2 exacta 7 2 63 68 1412 3617 analisis pengaruh variabel ekonomi makro terhadap indeks harga saham sektor industri manufaktur bei improving the students english reading comprehension ability by using reciprocal teaching technique perancangan prototype alat deteksi getaran menggunakan transmisi sinyal audio melalui media jala jala listrik perbedaan antara mahasiswa global analitis mereka prestasi belajar bahasa inggris pada mahasiswa tahun kedua dari sma negeri 1 pada mahasiswa tahun kedua dari sma negeri 1 pada mahasiswa tahun kedua dari sma negeri 1 pada mahasiswa tahun kedua sma negeri 1 bengkulu pada tahun akademik 2008 2009 bengkulu pada tahun akademik 2008 2009 bengkulu pada tahun akademik 2008 2009 bengkulu pada tahun akademik 2008 2009 fenomena pungutan liar kegiatan usaha pedagang kaki lima pasar minggu pagi kota bengkulu analisis penggunaan air bersih pdam tirta dharma kota bengkulu analisis potensi pengembangan aspek finansial industri rice milling unit rmu kota bengkulu pemanfaatan kalsium oksida cao cangkang kerang laut jenis remis meretrix sp lokan polymesoda expansa sebagai bahan pengganti sebagian semen pada beton uji validitas da realibitas pada pembukaan jurusan program statistika fmipa universitas bengkulu dengan metode split half analisis karakteristik pasang surut dengan metode admiralty perairan tapak paderi bengkulu penentuan batas bawah bilangan ramsey tipe kepribadian kecemasan berkomputer computer anxiety faktor demografi pada keahlian karyawan bagian akuntansi menggunakan komputer pendugaan heritabilitas sifat penting cabai persilangan talang semut tit super analisis pemberian insentif meningkatkan kualitas pelayanan kantor pertanahan kabupaten kepahiang efektivitas program latihan intensif terhadap kemampuan membaca cepat siswa kelas xi man 2 kota bengkulu tahun ajaran 2009 2010 perbandingan prinsip prinsip asuransi jiwa panerapan hukum asuransi konvensional asuransi syari ah perancangan prototype alat pengering terkontrol berbasis mikrokontroler avr 8535 fungsi n berl k nazhir d lakunya kecamat pen a undang an gadin ngelola undang ng cempa aan tanah nomor 4 aka kota h wakaf 41 tahun 2 a bengkul f setelah 2004 lu h pengaruh bauran promosi terhadap persepsi pemilihan calon legislatif pada pemilu 2009 kota bengkulu upaya peningkatan hasil belajar matematika siswa melalui penerapan model pembelajaran arias pada materi bentuk pangkat akar logaritma kelas x sman 4 bengkulu kajian pembuatan red palm olein rpo dengan bahan baku minyak sawit kasar yang ambil dari beberapa stasiun pengolahan crude palm oil cpo perilaku konsumen memilih merek sabun mandi kasus pada mahasiswa jurusan manajemen fakultas ekonomi universitas bengkulu analisis buku teks bahasa indonesia kelas x berdasarkan kurikulum tingkat satuan pendidikan ktsp yang digunakan sma negeri kota bengkulu tahun ajaran 2008 2009 the student development in extracurricular activities at state senior high school megang sakti pengaruh kinerja keuangan perusahaan terhadap harga saham bursa efek indonesia analisis kinerja pegawai pada mtsn 2 kota bengkulu pada pegawai tata usaha mtsn 2 kota bengkulu pengaruh kesetaraan gender terhadap perekonomian indonesia pengaruh laba akuntansi nilai buku per lembar saham total arus kas dengan market value akuntansi relevansi nilai analisis sikap konsumen terhadap atribut atribut retail image pada supermarket giant kota bengkulu jenis jenis tanaman hias pekarangan yang bermanfaat sebagai obat desa pagardin kecamatan dempo utara kota pagaralam sumatera selatan analisis kausalitas antara kredit perbankan pertumbuhan ekonomi kota palembang interest 12 2 73 81 1410 8828 analisis kadar kalsium pada kerabang yolk telur puyuh coturnix coturnix japonica pada beberapa tahapan umur inkubasi setelah pemberian pakan tepung kerabang telur puyuh uji aktivitas antibakteri minyak atsiri batang surian [toona sureni bl merr] terhadap bakteri escherichia coli bacillus cereus pemodelan bidang batas potongan lempeng tektonik berdasarkan data kegempaan propinsi bengkulu perilaku konsumen terhadap pembelian produk furniture pada toko frans bengkulu partisipasi masyarakat program pengentasan buta aksara deskriptif kualitatif penyelenggaraan pemberantasan buta aksara desa karang tengah kec tebat karai kabupaten kepahiang analisis roa roe per pada industri telekomunikasi yang listing bei tahun 2003 2007 analisis program penanggulangan pencegahan narkoba kalangan remaja oleh lembaga swadaya masyarakat kasus pada lsm layak kota bengkulu analisis presepsi konsumen terhadap strategi bauran pemasaran cinema complek 21 mega mall bengkulu an analysis of interaction among sub districts in kabupaten hak waris anak yang lahir dari perkawinan mut ah ditinjau dari hukum islam pendapat para ulama propinsi bengkulu respons lingkungan berbelanja sebagai stimulus pembelian tidak terencana pada toko grosir&eceran kasus konsumen yang berbelanja toko extra centre bengkulu marine geochemistry of zr hf nb ta mo and w technical report institute for chemical research kyoto university japan kyoto japan penerapan metode eksperimen meningkatkan prestasi belajar siswa pada mata pelajaran ipa kelas v b sd negeri 19 kota bengkulu pengaruh partisipasi penganggaran terhadap senjangan anggaran dengan informasi asimetri komitmen organisasi sebagai variabel pemoderasi empiris pada perusahaan perbankan kota bengkulu pembinaan keterampilan menjahit panti asuhan pengaruh proses pembuatan es krim terhadap mutu pengujian size hypothesis debt assets hypothesis bonus plan hypothesis yang mempengaruhi tingkat konservatisme laporan keuangan perusahaan dengan tehnik analisis multinomial logit karakteristik estuari selagan jaya kabupaten mukomuko bengkulu berdasarkan bilangan estuari tindak pidana pembajakan hak cipta ditinjau dari kuhp undang undang nomor 19 tahun 2002 tentang hak cipta kota bengkulu persepsi konsumen terhadap kualitas pelayanan hotel samudera dwinka bengkulu ketahanan pangan rumah tangga nelayan kecamatan pondok kelapa kabupaten bengkulu utara efektifitas taklik talak upaya mencegah terjadinya perceraian kota bengkulu eksperimen tentang penggunaan media dongeng pembelajaran pada anak usia dini paud dellia preferensi cacing tanah lokal pontoscolex corethrurus fr mull terhadap beberapa macam media pemeliharaan the analysis health quality of society in bengkulu city in before and era fiscal decentralization hubungan tarif media iklan promosi dengan citra merek brand image kartu prabayar mentari pada mahasiswa universitas bengkulu kewenangan mahkamah konstitusi membatalkan pemilihan umum kepala daerah analisis ketimpangan pembangunan antar kabupaten kota provinsi bengkulu pengaruh motivasi kerja tutor terhadap efektivitas pembelajaran pada program kelompok belajar paket b kejar binaan bpkb provinsi bengkulu kajian pemanfaatan tepung ampas tahu sebagai subtitusi tepung terigu pada pembuatan mie basah dengan penambahan air ki proses negosiasi yasva dengan pengacara pendampingan korban kekerasan rumah tangga kasus pada lembaga advokasi perempuan anak yasva bengkulu tingkat cekaman kekeringan dua hibrid kakao pa35xna32 pa35xna33 pada fase bibit analisis kebutuhan materi perkuliahan bahasa indonesia mahasiswa fakultas hukum universitas bengkulu model manajemen pendidikan berbasis solusi meningkatkan pengelolaan perpustakaan sekolah penelitian tindakan smp negeri 5 padang jaya kabupaten bengkulu utara pengaruh pengintegrasian pesan kewaspadaan narkoba meningkatkan pembelajaran kimia siswa sma plus negeri 7 kota bengkulu handphone hp sebagai media pembelajaran keaksaraan fungsional pembelajaran buta aksara desa peraduan binjai kecamatan tebat karai kabupaten kepahiang provinsi bengkulu peranan retribusi parkir peningkatan pendapatan asli daerah pad berdasarkan perda nomor 12 tahun 1999 tentang parkir kota bengkulu stability analysis of six chilli pepper populations using additive main effect multiplicative interaction ammi akta agrosia 12 2 147 154 1410 3354 tinjauan tentang penyegelan rumah ibadah kelurahan sidomulyo kota bengkulu perspektif hak asasi manusia penyelesaian delik adat tikam kecamatan jangkat kabupaten merangin provinsi jambi pengaruh strategi pembelajaran da gaya kognitif terhadap hasil belajar matematika siswa kelas viii smpn 13 kota bengkulu uji efektifitas minyak atsiri dari daun kemangi ocimum basillicum l sebagai bahan aktif losion antinyamuk aedes aegypti l laboratorium evaluasi tingkat erosi tanah pada sub mikro das lahan karet lahan kelapa sawit pengaruh orientasi etika terhadap hubungan antara time pressure dengan perilaku premature sign off prosedur audit analisis wacana iklan televisi kontribusinya terhadap bahan ajar bahasa indonesia smp pengaruh trust in brand terhadap brand loyalty konsumen produk eiger kota bengkulu peranan satuan polisi pamong praja penegakan peraturan daerah nomor 24 tahun 2000 tentang larangan pelacuran kota bengkulu transparansi penerimaan calon pegawai negeri sipil cpns pada kantor wilayah departemen agama provinsi bengkulu peningkatan hasil belajar kimia melalui penerapan metode heuristik dengan media powerpoint pada konsep hidrolisis garam kelas xi ipa sman 1 sarolangun 2 pemanfaatan ekstrak daun pacar kuku lawsonia inermis l kulit kayu jambu mete anacardium occidentale l daun bayam ungu althernanthera strigosa hask sebagai pewarna alami tekstil growth and production of chili cvinko 99 under bokashi treatments akta agrosia 12 2 113 123 1410 3354 kajian pembuatan arang aktif dari tempurung kelapa dengan aktifasi kalium hidroksida akibat hukum perceraian karena suami pidana penjara menurut kompilasi hukum islam pemanfaatan daun kayu jati tectona grandis linn kunyit curcuma domestica votil bunga kembang sepatu hisbiscus rosa sinensis l pada pewarnaan alami kulit lantung yang telah dipucatkan dengan larutan hidrogen peroksida h2o2 potensi energi panas bumi berdasarkan data gradien suhu bawah permukaan daerah gunungapi kaba bengkulu gradien 5 2 472 475 0216 2393 pemodelan sebaran sistem hidrotermal identifikasi jenis batuannya dengan metode csamt kasus gunungapi ungaran flux jurnal ilmiah fisika 6 1 40 49 1829 796x upaya meningkatkan hasil belajar mahasiswa pada matakuliah fisika modern melalui pendekatan konstruktivisme model pembelajaran kooperatif tipe jigsaw flux jurnal ilmiah fisika 6 2 121 131 1829 796x survai sebaran air tanah dengan metode geolistrik tahanan jenis konfigurasi wenner desa banjar sari kec enggano kab bengkulu utara gradien 22 26 0216 2393 analisis efisiensi akar tumbuhan bakau pantai sebagai redaman benturan energi ombak laut mengurangi abrasi pantai banjar sari pulau enggano bengkulu utara in seminar rapat tahunan bidang mipa badan kerjasama perguruan tinggi negeri bks ptn indonesia wilayah barat 4 5 mei 2009 banda aceh nangro aceh darussalam submitted pengaruh kapasitas individu yang diinteraksikan dengan locus of control terhadap budgetary slack the analysis of english teachers positive oral feedback to the students in teaching at man 1 curup perlindungan hukum bagi kosumen perumahan fasilitas kpr kredit pemilikan rumah kota bengkulu jaringan sosial jaringan pemasaran hasil ternak ayam broiler pt mitra ternak sejahtera pt mts kinerja guru pengelolaan pembelajaran bahasa inggris evaluatif sekolah menengah pertama negeri 1 2 serta sekolah menengah pertama xaverius kota lubuklinggau kekerasan rumah tangga perspektif hukum islam perbaikan sifat fisika ultisols melalui pemberian cma bokashi serta pengaruhnya terhadap produksi 5 varietas ubi jalar pengaruh penerapan metode pembelajaran modalitas belajar terhadap prestasi belajar matematika siswa kelas vii smp negeri 10 kota bengkulu manajemen dana bantuan operasional sekolah bos tingkat sekolah dasar deskriptif kualitatif kecamatan muara beliti musi rawas growth and yield of sweet corn grown organically using palm oil sludge at different doses and composting methods akta agrosia 12 2 99 105 1410 3354 pengaruh slump pemadatan terhadap kuat tekan beton growth and flowering of chrysantaemum under the application of palm bunch ash as potassium source akta agrosia 12 1 8 14 1410 3354 dampak kebijakan penurunan harga bahan bakar minyak terhadap kemiskinan perempuan kasus kelurahan malabro kecamatan teluk segara kota bengkulu analisis sistem fuzzy menggunakan tool box matlab kasus jumlah kasus malaria positif kota bengkulu peranan aparat kepolisian pemberantasan tindak pidana perjudian kota bengkulu peranan aparat kepolisian pemberantasan tindak pidana perjudian kota bengkulu partisipasi politik masyarakat etnis tionghoa kasus pada masyarakat etnis tionghoa kota bengkulu analisis disiplin efektivitas kerja pegawai negeri sipil pada biro administrasi umum keuangan bauk universitas bengkulu pengaruh disiplin kerja pendidikan terhadap kinerja pegawai pengadilan agama arga makmur pengaruh tekanan kerja terhadap kinerja manajerial dengan personalitas partisipasi anggaran sebagai variabel intervening pengaruh pengalaman pelatihan terhadap keahlian auditor kinerja pegawai bank bengkulu deskriptif kualitatif kantor pusat aplikasi logoka fuzzy pada kendali sistem pendulum terbalik akuntabilitas kinerja guru yang telah lulus sertifikasi pembelajaran evaluatif sekolah menengah pertama negeri 4 arga makmur pengaruh ekstrak daun katuk sauropus androgynus minyak ikan lemuru plus vitamin e terhadap performans ayam petelur manajemen pembelajaran ilmu pengetahuan alam penelitian evaluatif guru sertifikasi sekolah menengah pertama negeri 4 arga makmur upaya meningkatkan hasil belajar siswa melalui model pembelajaran berbasis assesment portofolio pada mata pelajaran pkn kelas iv sd negeri 03 kota bengkulu pembinaan pedagang kaki lima oleh unit pelaksana teknis dinas uptd pasar panorama kota bengkulu kesulitan menulis bahasa inggris yang dihadapi oleh mahasiswa dari bahasa inggris program universitas bengkulu pada semester kelima mahasiswa program bahasa inggris dari universitas bengkulu pada 2009 2010 tahun akademik analisa pengaruh budaya kerja pelatihan terhadap partisipasi masyarakat mengelolah jaringan irigasi air manjuto kiri desa tirta makmur kec air manjuto kabupaten mukomuko bimbingan guru terhadap anak sd menumbuhkan kecerdasan emosionalnya triadik 12 1 103 108 8053 8301 perbedaan harga saham volume perdagangan persentase spread sebelum sesudah pengumuman stock split bursa efek bengkulu mahasiswa meningkatkan 'membaca pemahaman belajar bahasa inggris melalui tugas berbasis pendekatan a penelitian tindakan kelas pada mahasiswa tahun pertama smpn 11 bengkulu prediksi laju sedimentasi melayang sungai serut bengkulu kota bengkulu pemanfaatan kitin kitosan dari cangkang kepiting sebagai adsorben ion seng terlarut air upaya peningkatan hasil belajar ilmu pengetahuan sosial ips dengan menerapkan metode brainstorming melalui kelompok kecil kelas v sdn 03 pondok suguh kabupaten mukomuko analisa kinerja pegawai sub bagian keuangan dinas perhubungan provinsi bengkulu pengaruh pemupukan kalium terhadap pertumbuhan hasil jarak pagar jatropha curcas l ade haryanto dibawah bimbingan hermansyah a hamim wicaksono 2009 56 halaman penerapan metode genius learning upaya meningkatkan aktivitas hasil belajar kimia siswa kelas xb sma negeri 6 kota bengkulu the effect of soil pasteurization alone or in combination with biological agents on heart rot disease pengembangan prototipe lembar kerja siswa lks berpola inkuiri pada pembelajaran biologi dengan metode karya wisata manajemen pembelajaran seni budaya perbandingan antara sekolah menengah pertama negeri 2 sekolah menengah pertama negeri 4 argamakmur kecamatan argamakmur kabupaten bengkulu utara penggunaan internet pembelajaran extensive reading in prosiding seminar rapat tahunan ke 5 bks ptn wilayah barat bidang bahasa tahun 2009 lembaga bahasa fkip unsri palembang 250 254 978 979 18565 5 3 problem regulasi berkendala linier prbl melalui pemrograman linier peranan komunikasi interpersonal guru bk bimbingan konseling mengurangi kenakalan siswa pada smk s4 pgri kota bengkulu analisis pendapatan usaha perkebunanan kelapa sawit rakyat faktor faktor yang mempengaruhinya kecamatan air periukan kabupaten seluma propinsi bengkulu akuntabilitas pengolahan kurikulum tingkat satuan pendidikan ktsp sekolah standar nasional evaluatif smp negeri 1 arga makmur pengaruh partisipasi penganggaran job relevant information terhadap informasi asimetri optimasi produksi roti tata bakery bengkulu the analyze urban poverty adressing program p2kp for society income in kota bengkulu studies case in kecamatan gading cempaka analisis faktor faktor yang mempengaruhi tingkat kepuasan kerja guru analisis kepuasan konsumen terhadap kualitas layanan puskesmas muara aman kabupaten lebong keterampilan menulis siswa meningkatkan 'melalui pembelajaran berbasis proyek pbl metode pengajaran sebuah eksperimental smkn 1 kota bengkulu pengaruh suplementasi tepung akar alang alang imperata cylindrica ransum terhadap performans ayam broiler kondisi sosial ekonomi perilaku masyarakat sekitar hutan kawasan hutan lindung bukit daun kasus desa pelangkian kecamatan kepahiang kabupaten kepahiang analisis koordinasi bappeda seluma terhadap dinas daerah lembaga teknis rangka keterpaduan program pembangunan kajian problematika kemampuan menulis karangan siswa smpn 12 curup prediksi kebangkrutan bank dengan menggunakan kombinasi rasio z score altman rasio keuangan camel model regresi poisson the effect of short story in improving students vocabulary mastery dampak informasi non keuangan terhadap hubungan antara informasi keuangan initial return pada perusahaan yang melakukan initial public offering bursa efek indonesia penggunaan pupuk daun manipulasi jumlah cabang yang ditinggalkan pada panen kedua tanaman nilam akta agrosia 12 2 194 203 1410 3354 laju konsumsi ikan cupang lokal betta samaradigna var sumatraensis sebagai alternatif pengendali populasi jentik nyamuk isolasi karakterisasi sifat sifat pektin dari kulit kakao theobroma cacao l upaya perlindungan terhadap hak cipta program komputer kota bengkulu meningkatkan kemampuan menulis karangan narasi dengan menggunakan media gambar seri pada mata pelajaran bahasa indonesia siswa kelas va sd negeri no 07 kota bengkulu guru merupakan elemen terpenting system pendidikan sebab tanpa guru maka penyelenggaraan pendidikan tidak akan terlaksana guru merupakan ujung tombak proses pembelajaran proses pembelajaran siswa sangat dipengaruhi oleh bagaimana kesiapan guru pelaksanaan pembelajaran dengan melakukan pelaksanaan inovasi pembelajaran implementasi model pembelajaran kooperatif tipe stad dengan menggunakan teknik berkirim salam soal meningkatkan hasil belajar kimia keaktifan siswa kelas x3 sma negeri 1 kota bengkulu pengaruh pemanasan bungkil inti sawit pakan konsentrat dengan pakan basal pelepah sawit terhadap pertambahan berat badan sapi bali meni p ingkatk pendeka kan has atan pe gunakan da kela mengg pad sil bela embelaj n model as iia sd a bengk kota ajar sisw jaran te l koope negeri kulu wa mela ematik eratif 65 alui faktor faktor yang mempengaruhi konsumen membeli rekaman cakram bajakan kota bengkulu the effect of word relationship technique toward students english vocabulary mastery pengaruh kepuasan kerja lingkungan kerja terhadap kinerja pegawai bagian umum lingkungan sekretariat daerah pemerintah kota bengkulu the roles of the teachers in increasing the quality of the class implementasi anggaran berbasis kinerja abk pada bendahara pengeluaran bp skpd sekretariat daerah propinsi bengkulu analisis pengendalian persediaan bahan baku pada perusahaan susu bubuk kedelai rizky bengkulu analisis critical path method cpm penyelesaian proyek kontruksi pada cv mitra karya analisis profesionalisme pegawai pembinaan narapidana lembaga pemasyarakatan klas ii a bengkulu analisis sektor ekonomi potensial kabupaten kaukus starakuat rangka kerja sama regional pemaknaan komunikasi visual pada desain iklan xl three analisis semiotika komunikasi visual pada iklan cetak xl localized versi umum three anti matigaya! versi buruh alternative strategy to improve suburban economy study case in pondok kelapa sub district persepsi mahasiswa terhadap jasa warnet finet kasus pada mahasiswa universitas bengkulu pemanfaatan ekstrak bunga kertas kulit bawang merah daun mangga sebagai alternatif zat warna alami terhadap pewarnaan kain katun batik besurek analisis efektivitas kerja pegawai kantor kecamatan muara bangkahulu kota bengkulu penerapan metode diskusi sebagai upaya meningkatkan prestasi belajar siswa pada mata pelajaran ipa kelas ivb sd negeri 19 kota bengkulu analisis kemampuan keuangan daerah kabupaten hasil pemekaran provinsi bengkulu menjalankan otonomi daerah tinjauan feminisme pada novel nayla penyelesaian sengketa hak pemeliharaan anak pengadilan agama kelas 1 a kota bengkulu upaya instruktur meningkatkan motivasi warga belajar pembelajaran pada kursus program aplikasi komputer lpka kota bengkulu analisis pembiayaan bidang kesehatan era desentralisasi kabupaten bengkulu utara pengembangan tanaman jahe sebagai bahan obat tradisional pada pertanaman jagung sistem tumpangsari jahe jagung in prosiding ii seminar nasional tumbuhan obat indonesia xxxvii universitas bengkulu bengkulu 356 365 978 979 9431 57 8 penghambat interaksi masyarakat pekal dengan masyarakat transmigrasi komunikasi antarbudaya evaluasi penerapan teori antrian meningkatkan pelayanan pada toko khatulistiwa bengkulu pelaksanaan pembelajaran matematika pada kelas unggul smp negeri 1 curup akibat hukum apabila terjadi kerusakan pinjam pakai benda ditinjau dari hukum islam hukum perdata kecamatan selebar kota bengkulu the implementation of instructional supervision done by principal and supervisor to improve the quality of instructional and learning at state senior high school number 2 lubuklinggau city pengembangan prototipe peta konsep berbantuan komputer sebagai media pembelajaran biologi sma pengaruh pendekatan kontekstual pembelajaran biologi melalui strategi inkuiri masyarakat belajar pada siswa dengan kemampuan awal berbeda terhadap hasil belajar kognitif sma negeri kota bengkulu triadik 12 1 33 43 8053 8301 pembentukan kecamatan kabupaten seluma setelah berlakunya undang undang nomor 32 tahun 2004 tentang pemerintahan daerah uji efektivitas ekstrak kulit buah manggis garcinia mangostana l terhadap penyembuhan luka bakar pada mencit rattus novergicus menghitung pengaruh perubahan arus pada konduktor acsr 185 mm 2 terhadap tegangan tarik andongan saluran transmisi udara 70 kv pekalongan bengkulu menggunakan program python 25 meningkatkan hasil belajar siswa dengan penerapan model pembelajaran penemuan terbimbing menggunakan metode sokrates pada mata pelajaran matematika kelas viii c smp negeri 10 kota bengkulu analisis kepuasan pelanggan terhadap kualitas pelayanan jasa pada bengkel sentral teknik bengkulu tindak pidana pemalsuan merek ditinjau dari kitab undang undang hukum pidana undang undang merek peningkatan hasil belajar ips melalui pendekatan inkuiri terbimbing penelitian tindakan kelas pada siswa kelas iv sdn 17 kota bengkulu meningkatkan hasil beajar siswa melalui penerapan teori belajar bermakna dengan menggunakan peta konsep kelas xi ia1 sma negeri 4 kota bengkulu p eni ngkatan kem amp uan menu li s lap oran p em belaj aran berbas i s p ortof oli o s i s wa kelas vi i i b mts negeri 2 bengku lu analisis perbandingan produktivitas pendapatan risiko usahatani cabai pada agroklimat yang berbeda propinsi bengkulu evaluasi strategi pemasaran dana multi proteksi dmp pada pt asuransi jiwasraya bengkulu penegakan peraturan disiplin pegawai negeri sipil menurut peraturan pemerintah nomor 30 tahun 1980 sekretariat daerah provinsi bengkulu analisis disparitas pembangunan ekonomi provinsi bengkulu dengan provinsi sumatera selatan peran partai politik kualitas fungsi dprd kabupaten musi rawas analisis kepuasan kerja pegawai biro pengelolaan keuangan sekretariat daerah propinsi bengkulu pengaruh pemberian getah buah pepaya muda terhadap kadar gula darah mencit mus musculus balb c pengadaan tanah kepentingan umum kabupaten kepahiang ditinjau dari peraturan presiden nomor 65 tahun 2006 jo peraturan presiden nomor 36 tahun 2005 peranan kantor taman budaya melestarikan kesenian rakyat bengkulu provinsi bengkulu analisis coping strategy jika menghadapi kerawanan pangan pada rumah tangga nelayan petani padi kabupaten mukomuko propinsi bengkulu pengaruh ketidaktentuan lingkungan terhadap penerapan sistem akuntansi manajemen struktur organisasi sebagai faktor moderasi uji pendahuluan penentuan kandungan senyawa alkaloid atau steroid serta bioassay pada beberapa tanaman sayuran aspek hukum kerja sama pembiayaan pd ldn asco mobil dengan ptoto multiartha kota bengkulu upaya tutor meningkatkan motivasi belajar warga belajar pada pelatihan menjahit balai pengembangan anak remaja harapan bengkulu wawancara terhadap responden perception of tax officer on the realization of land and building taxes and its resistance factors in bengkulu city perception of tax officer on the realization of land and building taxes and its resistance factors in bengkulu city peranan pemerintah kecamatan pelaksanaan pemugutan pajak bumi bangunan kasus kecamatan curup kota kabupaten rejang lebong analisis implementasi keputusan menteri pdt nomor 001 kep m pdt 02 2007 tentang percepatan pembangunan daerah tertinggal khusus p2dtk program infrastruktur kecamatan sukaraja kabupaten seluma analisis tingkat pelayanan ruas jalan kz abidin i terhadap kenyamanan pengguna jalan analisis pengaruh kebijakan struktur modal terhadap nilai perusahaan pada industri rokok yang listed bei tahun 2004 2007 peranan visum et repertum mengungkap tindak pidana perkosaan polres arga makmur peran istri pengolahan ikan kedudukan wali nikah pada perkawinan perempuan hamil luar nikah menurut hukum adat pasmah kecamatan simpang tiga kabupaten kaur kajian perancangan kompor sederhana berbahan bakar sekam dengan menggunakan kaleng bekas penerapan pembelajaran kooperatif dengan media kartu kerja kimia meningkatkan aktivitas hasil belajar kimia siswa perlindungan hak cipta karya fotografi ditinjau dari undang undang nomor 19 tahun 2002 korelasi antara career anchor pendidikan formal sales force pt mms prioritas bengkulu analysis of causing factor and the curing of children with tb peningkatan proses hasil pembelajaran matematika melalui pendekatan realistic mathematics education berbasis media visual kelas v sd negeri 13 kecamatan pondok suguh kabupaten mukomuko evaluasi pelaksanaan full day school sekolah dasar islam terpadu iqra 1 kota bengkulu faktor faktor yang mempengaruhi perilaku komplain konsumen perbandingan frekuensi aktivitas hasil belajar siswa antara siswa yang menggunakan media nyata media gambar pokok bahasan kubus balok kelas viii smpn 20 kota bengkulu manajemen kelas guru matematika perbandingan antara sma negeri i sma negeri ii argamakmur bengkulu utara persepsi mahasiswa pls terhadap program pkl pkbm kota bengkulu tahun ajaran 2007 2008 khususnya pada mahasiswa pls angkatan 2004 pemanfaatan jasa dukun bayi terlatih sebagai tenaga penolong persalinan laporan penelitian fundamental pengaruh charge transfer comlexes ctc dari teracyanoquiodimethane tcnq oligotiofena terhadap sifat bahan berpori berbasis silikon project report lembaga penelitian universitas bengkulu bengkulu teachers professionalism at vocational high school descriptive qualitative study at public vocational high school number 3 lubuklinggau city penerapan asas praduga tak bersalah proses peradilan pidana tindak pidana korupsi kota bengkulu manajemen kelas guru kelas satu perbandingan antara sd negeri 13 sd negeri 24 argamakmur bengkulu utara pendugaan kedalaman ketebalan zona lemah yang berpotensi menimbulkan amblesan permukaan jalan dengan metode geolistrik tahanan jenis manajemen pembelajaran bahasa indonesia perbandingan antara sekolah dasar negeri 01 giri mulya madrasah ibtidaiyah darul hikmah padang jaya kabupaten bengkulu utara penerapan supervisi klinis meningkatkan kompetensi profesional guru penelitian tindakan sekolah menengah pertama negeri 1 arga makmur kajian terhadap keterpenuhan standar nasional pendidikan sekolah dasar evaluasi sekolah dasar negeri 10 padang jaya penerapan model pembelajaran cooperative learning teknik make a match dengan bermain peran sebagai upaya meningkatkan prestasi belajar pkn siswa kelas va sd negeri no 07 kota bengkulu pengaruh mekanisme corporate governance terhadap earnings prestasi kerja karyawan asuransi jiwa bersama bumiputra 1912 rayon bengkulu deskriptif kualitatif analisis kinerja saham kinerja keuangan perusahaan perusahaan yang melakukan right issue indonesia tahun 1992 2000 tanggung jawab penanggung terhadap risiko yang menimpa tertanggung ditinjau dari asuransi kerugian konvensional asuransi kerugian islam upaya meningkatkan kemampuan menulis teks drama dengan transformasi buku cerita rakyat ptk sma negeri 1 curup kota ta 2008 2009 peranan inspektorat kota bengkulu pengawasan pembinaan aparatur kota bengkulu pemanfaatan limbah cair pengolahan kelapa sawit pembuatan biokerosene implementasinya pada pembelajaran kimia sma manajemen kelas berbasis partisipatif meningkatkan proses hasil pembelajaran pendidikan agama penelitian tindakan smpn 3 girimulya bengkulu utara sistem pembinaan pegawai negeri sipil lingkungan sekretariat daerah kabupaten musi rawas mewujudkan pemerintahan yang bersih analisis putusan kppu komisi pengawas persaingan usaha tentang kepemilikan saham silang cross ownership oleh temasek holdings praktik monopoli pt telkomsel kasus putusan kppu perkara nomor 07 kppu l 2007 peningkatan efektivitas fusarium sp isolat pisang jeruk dengan konsentrasi tinggi menginduksi akumulasi resin gaharu pada aquilaria malaccensis analisis faktor faktor yang mempengaruhi pemakaian telepon rumah tangga kabupaten rejang lebong kasus kelurahan sukaraja kajian uji lanjut dari anava rancangan acak lengkap kajian kualitas air limbah terhadap baku mutu limbah cair ipal rsud dr m yunus bengkulu upaya tutor memacu perkembangan potensi peserta didik pada lembaga paud pelita hati kota bengkulu pengaruh pemberian getah buah pepaya carica papaya linn pada mencit mus musculus balb c jantan terhadap fertilitas mencit mus musculus balb c betina motivasi kerja karyawan pt agromuko btpom kabupaten mukomuko pertumbuhan bibit 11 genotipe kopi pada tiga ukuran polibag pengaruh pelatihan logika terhadap pertimbangan audit audit judgment analisis peran manajerial organisasi entertainment kota bengkulu study kasus pada sanggar tari pengaruh motivasi kerja terhadap prestasi kerja pegawai pada kantor kecamatan arga makmur students self esteem in learning english motivasi pegawai lembaga penjamin mutu pendidikan provinsi bengkulu analisa tingkat pengendalian persediaan bahan baku kertas yang optimal pada percetakan pondok makmur muko muko keragaan empat varietas lokal padi pada pemberian amelioran tanah ultisol abu sekam padi dolomit lahan gambut akta agrosia 12 1 45 50 1410 3354 penerapan pengorganisasian pada pusat kegiatan belajar masyarakat pkbm widex mulia kota bengkulu analisis pengaruh kualitas audit debt default opinion shopping terhadap penerimaan opini going concern kajian penggunaan zeolit alam menurunkan bod cod air gambut pengetahuan awal siswa sma negeri i kota bengkulu pada mata pelajaran biologi materi sistem gerak pada manusia penerapan pembelajaran tematik model quantum teaching tandur meningkatkan aktivitas prestasi belajar siswa kelas ii sdn 38 kota bengkulu perbandingan pengelolaan kurikulum tingkat satuan pendidikan ktsp sd negeri 10 padang jaya sd negeri 18 argamakmur kabupaten bengkulu utara persepsi konsumen terhadap iklan humor televisi implikasinya terhadap strategi promosi hubungan karakteristik ibu rumah tangga terhadap kebersihan lingkungan kelurahan jalan baru kecamatan curup kabupaten rejang lebong kekerasan rumah tangga kdrt sebagai penyebab terjadinya perceraian pengadilan agama kelas ia bengkulu kajian metode optimasi nonlinier metode rasio emas menentukan akar persamaan nonlinier pengaruh variasi kecepatan waktu sentrifugasi terhadap kualitas kuantitas pembuatan minyak kelapa murni virgin coconut oil dengan menggunakan asam asetat analisis implementasi transparansi partisipasi pengelolaan keuangan daerah kabupaten bengkulu utara analisis pengawasan pimpinan bidang teknik meningkatkan pelayanan konsumen pada perusahaan daerah air minum pdam kota bengkulu kajian variasi kadar sukrosa pada pembuatan nata de coco dengan penambahan ekstrak ampas nenas ananas comosus l merr sebagai medium campuran kewajiban badan amil zakat baz peningkatan taraf hidup fakir miskin provinsi bengkulu empiris faktor faktor yang mempengaruhi struktur modal pada industri farmasi bursa efek indonesia periode tahun 2003 2007 perbandingan hasil belajar respon siswa antara model pembelajaran kooperatif stad dengan two stay two stray pembelajaran matematika smp negeri 2 pondok kelapa bengkulu utara pendugaan fungsi keuntungan efisiensi usaha tani padi sawah teknik budidaya sintem legowo kasus dusun besar kecamatan gading cempaka kota bengkulu contextual teaching and learning melalui model pembelajaran kooperatif tipe stad sebagai upaya meningkatkan hasil belajar biologi siswa kelas viiia smpn 11 kota bengkulu kajian pemilihan bentuk produk nilai tambah ice cream pembelajaran kimia dengan bantuan bahan ajar berbentuk cd sebagai upaya meningkatkan hasil belajar kimia siswa dengan pendekatan konstrukstivisme melalui pembelajaran kooperatif sma negeri 4 kota bengkulu peningkatan kemampuan apresiasi cerpen dengan menggunakan model taba inductive thinking pada mata pelajaran bahasa indonesia siswa kelas v sd n 01 tegalrejo musi rawas upaya peningkatan hasil belajar fisika siswa kelas x a sma negeri 9 kota bengkulu melalui pembelajaran berbasis component display theory cdt dengan metode eksperimen pada konsep kinematika gerak upaya pendidik meningkatkan kemampuan anak paud mengingat kosakata melalui aktivitas bernyanyi ptk pada paud fatonah kabupaten kepahiang keberhasilan madrasah diniyah awaliyah mda baitul atieq meningkatkan keterampilan membaca al quran pada anak pengaruh pemberian pakan kroto rang rang oerophylla smaragdina jangkrik brachytrypes membranaceus pakan campuran terhadap performans anak walet putih analisis pola pergerakan harga harga sham saham unggulan bursa efek indonesia hubungannya dengan indeks harga saham gabungan ihsg penerapan rapat rutin berbasis solusi meningkatkan kompetensi guru penelitian tindakan sekolah menengah pertama negeri 3 padang jaya kabupaten bengkulu utara pengaruh gaji iklim organisasi penugasan terhadap kepuasan kerja karyawan pt agung automall bengkulu jenis gulma hasil padi jagung kacang tanah pada sistem monokultur tumpangsari jarak pagar pengaruh komitmen terhadap kepuasan kerja motivasi sebagai variabel intervening penerapan pasal 56 kuhap tentang bantuan hukum terhadap tersangka terdakwa proses peradilan pidana kota bengkulu peningkatan kemampuan menulis puisi siswa kelas x sman 4 kota bengkulu dengan pendekatan kontekstual perlindungan hukum bagi wartawan indonesia pengaruh pemberian getah buah pepaya carica papaya l terhadap daya fertilitas mencit mus musculus balb c betina analisis perilaku konsumen membeli produk produk syngenta kasus kecamatan ketahun kabupaten bengkulu utara pengaruh vermikompos terhadap pertumbuhan produksi tanaman bawang merah allium ascalonicum l korelasi indeks harga saham gabungan ihsg harga saham saham unggulan bursa efek indonesia pola komunikasi pasangan suami istri terhadap perceraian study kasus perceraian pada isteri berkarier sebagai pegawai negeri sipil pns kecamatan gading cempaka kota bengkulu peranan kepala sekolah pengelolaan sekolah bertaraf internasional sbi sdn 1 kota bengkulu analisis fungsi produksi efisiensi alokatif usahatani jagung desa riak siabun kecamatan sukaraja kabupaten seluma propinsi bengkulu peran populasi cacing tanah pontoscolex corethrurus fr mull terhadap pertumbuhan produksi tanaman organik bawang merah analisis kinerja perawat pelakasana berdasarn faktor internal external rsud dr m yunus bengkulu the analysis of people consumption pattern of raskin receivers in kampung kelawi district tinjauan psikologi kriminal terhadap kejahatan perkosaan pada anak kota bengkulu respon perkecambahan lima varietas padi rawa lebak terhadap pemberian zat pengatur tumbuh 2 4 d pada fase vegetatif lapangan akta agrosia 12 2 177 183 1410 3354 pengembangan bahan ajar cal computer assisted learning biologi berpola induktif pada pokok bahasan prinsip hereditas sma kelas xii sebagai alternatif media pembelajaran research and development pertumbuhan agen antagonis pada seresah daun akasia potensinya mengendalikan patogen busuk akar acacia mangium willd secara in vitro efektivitas soal ujian nasional mata pelajaran bahasa indonesia terhadap ktsp sekolah menengah pertama pengembangan prototipe slide komputer berpola induktif pembelajaran biologi sma pada konsep pengelompokan makhluk hidup penggunaan ganja pada masyarakat nelayan pada mantan pengguna ganja kelurahan pondok besi kecamatan teluk segara kota bengkulu bilangan ramsey r k 1 11 k 2 2 penerapan asas praduga tak bersalah terhadap tersangka polres bengkulu induksi pertumbuhan eksplan bawang putih allium sativum l umbi seribu manfaat media cair secara in vitro in seminar nasional tanaman obat indonesia 11 12 november 2009 universitas bengkulu bengkulu submitted micropropagation of fungal free plantlet of indigenous banana ‘ambon curup in bengkulu in poster in international seminar of biotechnology biodiversity and crop production university of andalas padang 17 maret 2009 padang unpublished mikropropagasi jahe zingiber officinale rosc sebagai bahan fitofarmaka potensial in seminar nasional tanaman obat indonesia 11 12 november 2009 universitas bengkulu bengkulu submitted mikropropagasi jahe in vitro in poster pada simposium pameran poster produk 11 12 mei 2009 bengkulu unpublished pengaruh tax payer pelayanan informasi perpajakan terhadap kepatuhan wajib pajak perseorangan melaksanakan kewajiban perpajakan pajak penghasilan evaluasi rka kl terhadap pelaksanaan anggaran berbasis kinerja pada balai wilayah sungai sumatera vii penggunaan multimedia interaktif meningkatkan penguasaan konsep siswa smp pada materi pengukuran fisika exacta 7 2 34 39 1412 3617 service quality and customer satisfaction case study of mk restaurant songkhla thailand kinerja finansial tiga pedagang besar beras kota bengkulu kasus pada ud 9 pilar ud satu putri ud hery pasar panorama bilangan ramsey 2 improving students reading comprehension by using cooperative learning jigsaw model pengaruh perilaku waria perkembangan perilaku remaja kecamatan seginim kabupaten bengkulu selatan analisis interaksi sosial antara korban pelaku kekerasan rumah tangga kasus kecamatan gading cempaka kota bengkulu komunitas kaum gay kota bengkulu kajian tentang jaringan sosial komunitas gay kota bengkulu penerapan media pembelajaran berbasis powerpoint melalui model pembelajaran langsung direct intruction meningkatkan hasil belajar siswa pada konsep alat alat optik kelas viii smp negeri 11 kota bengkulu c penerapan standar pengelolaan penerimaan siswa baru smpn perbandingan antara smpn 1 dengan smpn 2 padang jaya kabupaten bengkulu utara pengaruh keahlian individu pendidikan lingkungan kerja terhadap prestasi kerja karyawan pada pt federal international finance cabang bengkulu latihan kepemimpinan dasar meningkatkan kompetensi kepemimpinan pengurus organisasi siswa intra sekolah osis penelitian tindakan sekolah menengah atas negeri i padang jaya kabupaten bengkulu utara pengaruh upah jam kerja terhadap produktivitas kerja karyawan bulanan tetap kbt pada pt bio nusantara teknologi bengkulu pengembangan prototipe media transparansi warna berpola induktif pembelajaran konsep struktur fungsi organ manusia sma pengaruh pemberian getah buah pepaya carica papaya l terhadap pertumbuhan tulang tengkorak cranium tulang belakang vertebrae tulang rusuk costae fetus mencit mus musculus balb c robot line follower dengan kendali pid media informatika 7 1 49 75 0854 4743 recruitment system selection placement and development the teacher and headmaster of junior high school in seluma peran orang tua memberikan informasi tentang pendidikan seks pada remaja kasus kecamatan gading cempaka kota bengkulu pemanfaatan limbah tulang ikan tenggiri menjadi kerupuk berkalsium kasus industri pempek buffet dwili lingkar timur bengkulu pelaksanaan peraturan pemerintah nomor 41 tahun 2007 tentang organisasi perangkat daerah pemerintahan daerah kota bengkulu uji efektivitas ekstrak daun ubi jalar merah ipomoea batatas poir sebagai antibakteri staphylococcus aureus penyebab penyakit bisul pada manusia pengaruh kecepatan alat pengaduk lama pengadukan pada proses ekstraksi teripang pasir holothuria scabra sebagai sumber testosteron antigen pengaruh pengemasan kondisi penyimpanan terhadap pendugaan umur simpan produk olahan ikan bledang trichiurus lepturus siap saji kota bengkulu analisis kepuasan kerja pegawai negeri sipil dinas energi sumber daya mineral propinsi bengkulu pemberdayaan bagi masyarakat miskin melalui p2kp kasus bkm kelurahan tanjung agung kecamatan sungai serut kota bengkulu penerapan peta pikiran dengan pendekatan contextual teaching and learning ctluntuk meningkatkan prestasi belajar siswa pada mata pelajaran ips kelas vc sd negeri 69 kota bengkulu analisis peranan camat pengawasan pembinaan pemerintah desa kasus kecamatan rimbo pengadang kabupaten lebong pengaruh tingkat cekaman kekeringan pada fase bibit tanaman kakao f1 hasil persilangan uit1xpa7 uit1xna33 uit1xna32 penerapan analisis kuadran customer satisfaction index csi penentuan tingkat kepuasan pengunjung perpustakaan unib kinerja kepala sekolah pembinaan guru evaluasi smp satu atap arga makmur kabupaten bengkulu utara analisis efektivitas implementasikalender akademik universitas bengkulu persepsi konsumen terhadap objek wisata danau mas harun bestari curup kabupaten rejang lebong pelaksanaan otonomi desa pada desa tertinggal kecamatan ujan mas kabupaten kepahiang ditinjau dari undang undang nomor 32 tahun 2004 analisis peranan kantor taman budaya melakukan pembinaan kesenian tabot kota bengkulu penggunaan kontrasepsi hormonal pada pasangan usia subur pus wilayah puskesmas air bintunan kecamatan girimulya bengkulu utara teknologi grafting fase serdadu kopi arabika unggul pada dataran rendah berdasarkan isoenzym peroksidase aktifitas nitrat reduktase project report lembaga penelitian universitas bengkulu bengkulu unpublished variabilitas heritabilitas aktivitas nitrat reduktase karakter daun kopi arabika dataran rendah akta agrosia 12 2 167 172 1410 3354 persepsi tutor keaksaraan fungsional program kkn ppba terhadap pendidikan pelatihan yang diselenggarakan oleh universitas bengkulu tahun 2008 analisis pengaruh rasio likuiditas leverage aktivitas profitabilitas terhadap return saham kasus perusahaan farmasi yang listed bei 2001 2006 penerapan standar akuntansi pemerintahan menunjang efisiensi efektivitas pengelolaan keuangan daerah kesalahan siswa menyelesaikan soal cerita pada pelajaran matematika sd negeri 22 bengkulu peran kepala sekolah dasar pengembangan profesionalisme guru triadik 12 1 93 102 8053 8301 pengaruh konsentrasi katalis hcl lama pemanasan terhadap kadar glukosa hasil hidrolisis pati fraksi amilopektin biji mangga varietas manalagi mangifera indica l analisis kualitas pelayanan jasa biro perjalanan bengkulu ite tour & travel pelacakan pola silsilah beberapa keluarga diabetes melitus kelurahan suka merindu kecamatan sungai serut kota bengkulu pengelolaan perpustakaan sekolah evaluatif smp negeri 2 kota bengkulu pengaruh kepemimpinan struktur terhadap efektivitas terhadap kinerja kasubag lingkungan sekretariat daerah provinsi bengkulu strategi pemasaran benih padi pt pertani persero cab pemasaran bengkulu manajemen kurikulum tingkat satuan pendidikan sekolah menengah pertama penelitian evaluasi sekolah menengah pertama negeri 5 argamakmur pengembangan karier personal karyawan pt bank bengkulu cabang utama kota bengkulu analisis karakteristik pola sebaran gempa tektonik tahun 2000 2007 provinsi bengkulu resepsi siswa sma n 9 kota bengkulu terhadap novel laskar pelangi karya andrea hirata analisis fenomena cerai gugat kasus cerai gugat kota bengkulu behaviors of dissolved and particulate co ni cu zn cd and pb during a mesoscale fe enrichment experiment seeds ii in the western north pacific deep sea research ii 56 2822 2838 0967 0645 perubahan upacara perkawinan adat suku bangsa serawai kecamatan talo kabupaten seluma haipersex sebagai alasan berpoligami the efforts of improving performance in the public relation of national education department of bengkulu city sifat kekuatan sifat optik lembaran pulp sulfat amomum maximum auct amomum walang blval kontribusi bea perolehan hak atas tanah bangunan bphtb terhadap penerimaan daerah kota bengkulu analisis efisiensi usaha tangkap lobster panulirus sp faktor faktor yang mempengaruhinya hubungan motivasi terhadap faktor pilihan minat mahasiswa jurusan akuntansi fakultas ekonomi universitas bengkulu faktor faktor yang berhubungan dengan konversi lahan dari usahatani jagung ke kelapa sawit kecamatan sukaraja kabupaten seluma propinsi bengkulu peran kepala sekolah guru mengembangkan budaya sekolah unggul smk negeri 3 lubuklinggau deskriptif kualitatif analisis regresi linier berganda dengan prosedur akar upaya mengefektifkan pekerjaan rumah dengan menerapkanpendekatan team based learning tbl pada mata pelajaran matematika meningkatkan aktivitas hasil belajar siswa kelas xi ipa sma negeri 10 bengkulu pertumbuhan hasil jarak pagar dengan dosis pupuk nitrogen yang berbeda jaringan sosial jaringan pemasaran pada komunitas nelayan uji validitas berbagai uji reliabilitas instrumen penelitian yang berupa tes non tes uji aktivitas antibakteri ekstrak buah sawo acrhras zapotal dengan n heksana metanol sebagai ekstraktan terhadap bakteri escherichia coli bacillus cereus inventarisasi jenis jenis anggrek famili orchidaceae depot depot bunga kota bengkulu sebagai sumber pembelajaran biologi sma perencanaan kebutuhan bahan pakaian sekolah tentang perbandingan pemberian latihan soal berjenjang terhadap hasil belajar siswa pada pembelajaran matematika kelas vii smp negeri 01 pondok kelapa bengkulu tengah pengaruh penyimpanan konsentrasi ekstrak jeruk nipis citrus aurantifolia swingle terhadap aktivitas pencoklatan enzimatik ph umbi kentang varietas granola solanum tuberosum l pemanfaatan arang aktif dari cangkang kelapa sawit sebagai adsorben mengurangi kadar ion mangan terlarut air penerapan model pembelajaran kooperatif tipe nht numbered head together dengan teknik mind mapping sebagai upaya meningkatkan hasil belajar kimia aktivitas siswa kelas x sma n 1 bengkulu selatan kandungan informasi pelaporan kerugian hubungannya dengan pergerakan return saham penerapan pembelajaran tematik berbasis kebun sekolah antar bidang model jaring laba laba meningkatkan prestasi belajar siswa kelas iii sekolah dasar negeri 03 kecamatan sungai rumbai kabupaten mukomuko analisa pengaruh locus of control self efficacy terhadap transfer pelatihan pada pegawai pemda propinsi bengkulu penentuan daerah rawan tsunami kota bengkulu dengan menggunakan analisis spasial pada sistem informasi geografis melalui aplikasi arcview st strate g k udi buruh gi pemen keluarg i pasar pur angkut nuhan ke ga buruh rwodadi ar ebutuha h angkut rga makmu an pokok t ur kabben k ngkulu uta ara model pembelajaran picture and picture meningkatkan hasil belajar siswa pada mata pelajaran pkn kelas iv sd negeri 17 kota bengkulu perlindungan hukum terhadap pengguna internet banking pada pt bank bri cabang bengkulu pemekaran desa ditinjau dari peraturan menteri negeri nomor 28 tahun 2006 tentang pembentukan penghapusan penggabungan desa perubahan status desa menjadi kelurahan analisis struktur retorika pidato penceramah agama terkemuka kota bengkulu serta implementasinya pemelajaran berbicara siswa sma kajian metode optimasi non linier metode pencarian bebas menentukan akar persamaan non linier pola asuh orang tua pada aktivis perempuan bengkulu jenis jenis burung liar lalat yang berpotensi sebagai vektor virus avian influenza subtype h5ni cagar alam air rami i cagar alam air rami ii kabupaten mukomuko provinsi bengkulu pertumbuhan awal kayu bambang lanang madhuca aspera hjlam terhadap variasi tinggi bibit variasi lubang tanam upaya peningkatan hasil belajar kimia siswa dengan menerapkan model reciprocal teaching pada pokok bahasan stoikiometri kelas xc sman 9 kota bengkulu penerapan pembelajaran kooperatif tipe stad student teams achievement divisions dapat meningkatkan hasil belajar matematika siswa mts n i kota bengkulu kinerja kepala sekolah memenuhi mutu input berdasarkan standar jaminan mutu pendidikan evaluatif sdit iqra i kota bengkulu faktor faktor yang mempengaruhi kinerja perawat penunjang medis pada rumah sakit umum daerah rsud dr m yunus bengkulu penggunaan tindak tutur guru kegiatan belajar mengajar bahasa indonesia smp negeri 15 seluma laporan hasil penelitian kajian komprehensif unit pengelola keuangan desa upkd probabilitas kegagalan pengelolaannya pasca bengkulu regional development project brdp kabupaten bengkulu utara project report lembaga penelitian universitas bengkulu bengkulu pengisian jabatan struktural berdasarkan peraturan pemerintah nomor 41 tahun 2007 pemerintah daerah kota bengkulu analisa kinerja keuangan pengaruhnya terhadap dividen payout ratio pada industri makanan minuman yang listed bei kajian uji nonparametrik pengaruh perlakuan tetap pada rancangan acak lengkap analisis abrasi pantai jalan lintas barat sumatra kasus desa air dikit mukomuko bengkulu talak rujuk perspektif hukum perkawinan islam analisis kepuasan konsumen terhadap pelayanan cinema 21 bengkulu penentuan pengaruh voltage sag terhadap perencanaan pemasangan under voltage relay pt sinar harapan teknik bengkulu pembelajaran matematika dengan pendekatan pembelajaran tuntas melalui media kartu soal pada bentuk aljabar meningkatkan hasil belajar siswa kelas vii smpn 2 pondok kelapa the effect of picture card games to students of elementary school s vocabulary mastery penerapan model daur belajar 5e secara kooperatif pembelajaran biologi meningkatkan kompetensi siswa kelas xc sman 9 kota bengkulu ar dikaji menurut kitab undang undang hukum pidana hukum islam analisis respons siswa smpn 18 kota bengkulu terhadap cerpen terbaik kompas tahun 2005 2008 ripin sini dingin sekali cinta atas perahu cadik sinai kontribusi keterkaitan sektor pertanian terhadap perekonomian propinsi bengkulu analisa input output faktor faktor yang mempengaruhi struktur modal pada perusahaan farmasi periode 2003 2007 perbandingan tentang tindak pidana penganiayaan menurut kitab undang undang hukum pidana hukum pidana islam jinayat tingkat pengembalian kredit anggota koperasi lepp m3 kota manna kabupaten bengkulu selatan penentuan batas bawah bilangan ramsey tinjauan psikologi kriminal terhadap pelaku pedofilia kota bengkulu analisis metode dekomposisi dantzig wolfe pada penyelesaian problem program linier ndungan hukum terhadap saksi tindak pidana korupsi ditinjau dari undang undang nomor 13 tahun 2006 tentang perlindungan saksi korban kaji an putusan mahka mah k onsti tusi no mor 57 phpu d vi 2008 tentang perselisi han hasi l pemi lukada kabupaten bengkulu se latan kaji an putusan mahka mah k onsti tusi no mor 57 phpu d vi 2008 tentang perselisi han hasi l pemi lukada kabupaten bengkulu se latan kaji an putusan mahka mah k onsti tusi no mor 57 phpu d vi 2008 tentang perselisi han hasi l pemi lukada kabupaten bengkulu se latan analisis pelaksanaan corporate social responsibility prinsip good corporate governance pada pt astra motor padang jati bengkulu perbedaan motivasi serta hasil belajar siswa melalui model pembelajaran kooperatif tipe stad menggunakan penyusunan bagan materi tanpa penyusunan bagan materi pada bangun segiempat kelas vii smpn 2 kota bengkulu analisis pengendalian persediaan bahan baku pada usaha kopi bubuk putri kenanga bengkulu analisis perancangan pembuatan alat penyulingan nilam dengan uap upaya pengembangan sumberdaya manusia pada usaha kain batik besurek kota bengkulu perlindungan hukum bagi konsumen siaran televisi berlangganan indovision pt indovision cabang bengkulu kajian sumber sumber informasi teknologi usahatani padi sawah pada tingkat petani kota bengkulu analisis kualitas pelayanan servqual pada grapari telkomsel bengkulu populasi conopomorpha cramerella snellen helopeltis spp serta kerusakan buah kakao theobroma cacao l desa serumbung kecamatan kerkap bengkulu utara analisis fuzzy quantification theory 1 mengukur pengaruh kinerja mengajar dosen terhadap tingkat kelulusan mahasiswa mata kuliah kasus fmipa universitas bengkulu kebijakan pemerintah daerah kabupaten lebong melestarikan hutan lindung taman nasional kerinci seblat tnks isolasi karakterisasi kitin dari limbah cangkang lokan polymesoda expansa keanekaragaman anura sekitar kawasan taman nasional kerinci seblat tnks desa air putih kecamatan lebong utara kabupaten lebong evaluasi kinerja program perbaikan gizi masyarakat dinas kesehatan propinsi bengkulu penggunaan peta konsep sebagai media pembelajaran pkn meningkatkan hasil belajar siswa kelas ivc sd negeri 69 kota bengkulu uji fungsi aktivasi sigmoid biner sigmoid bipolar terhadap keakurasian jaringan syaraf tiruan backpropagation peramalan usaha guru sekolah menengah kejuruan menghadapi sertifikasi deskriptif kualitatif smk negeri 1 arga makmur strategi bauran pemasaran terhadap volume penjualan perusahaan roti surya bengkulu pengaruh konservatisme laporan keuangan terhadap earnings response coefficient analisis kepuasan konsumen pada solaria café & resto pada mega mall bengkulu pembuatan bioriket tanpa pengarangan dari tandan kosong kelapa sawit sebagai bahan bakar alternatif pemberian kompensasi guru honor deskriptif kualitatif pada sd negeri 43 44 45 46 47 85 kota lubuklinggau produktivitas lahan nkl pada tumpang sari jarak pagar dengan tanaman pangan akta agrosia 12 1 51 55 1410 3354 analisis pelaksanaan program makanan pendamping air susu ibu mp asi meningkatkan status gizi balita analisis pemanfaatan pasir sungai provinsi bengkulu terhadap kuat tekan beton strategi komunikasi politik calon legislatif perempuan pada pemilu 2009 kasus pada calon legislatif perempuan propinsi bengkulu upaya peningkatan hasil belajar fisika siswa dengan menerapkan model cooperative learning tipe jigsaw pada konsep teori kinetik gas kelas xi ipa d sman 2 kota bengkulu analytic hierarchy process sebagai metode pengambilan keputusan berbasis multikriteria peranan sub sektor perikanan mendukung perekonomian kota bengkulu pemanfaatan kitosan dari limbah cangkang udang sebagai adsorben menyerap ion logam merkuri hg air penentuan lokasi optimal penggunaan kapasitor bank pada jaringan distribusi primer bengkulu menggunakan simulasi visual basic 60 identifikasi kualitas soal tes sumatif fisika sma negeri kota bengkulu kelas x semester ii tahun ajaran 2008 2009 pemanfaatan ekstrak kulit ari biji buah kelor moringa oleifera lamk mengurangi kadar ion tembaga cu terlarut air konversi gliserol melalui reaksi fermentasi reaksi cracking dengan katalis zeolit serta implementasi pada pembelajaran kimia sma penentuan lapisan akuifer dengan menggunakan metode geolistrik tahanan jenis konfigurasi schlumberger kasus kelurahan masmambang kabupaten seluma propinsi bengkulu evaluasi kinerja saluran udara terhadap sambaran petir penentuan lokasi rawan dengan menggunakan metode severity index kasus sutt 70 kv penghantar pekalongan bengkulu the effect of peat subsidence on soil taxonomic changes in oil palm plantation in bengkulu akta agrosia 12 1 28 34 1410 3354 analisis break even point menetapkan volume produksi volume penjualan tbs kelapa sawit pt lakemba analisis iklim organisasi efektifitas kerja buruh pelabuhan indonesia ii pulau baai bengkulu pengaruh motivasi budaya organisasi terhadap kinerja karyawan bank mandiri cabang s parman bengkulu komunikasi penyebaran informasi pembangunan pemanfaatan kitin kitosan dari cangkang kepiting sebagai adsorben ion besi terlarut air inventarisasi kantong semar nepenthes spp cagar alam danau dusun besar kota bengkulu sebagai alternatif sumber belajar biologi sma pada pokok bahasan keanekaragaman hayati peran populasi cacing tanah pontoscolex corethrurus fr mull terhadap pertumbuhan produksi tanaman kangkung organik ipomoea reptans poir upaya meningkatkan kemampuan menulis siswa dengan menggunakan media gambar pada mata pelajaran bahasa indonesia kelas iv sekolah dasar negeri 17 kota bengkulu peningkatan disiplin siswa kelas x melalui penerapan buku tata tertib laporan kepribadian penelitian tindakan sekolah menengah atas negeri 1 padang jaya kabupaten bengkulu utara hubungan antara pengetahuan guru tentang manajemen kelas komitmen terhadap tugas dengan kemampuan guru melaksanakan manajemen kelas sma negeri 1 arga makmur kabupaten bengkulu utara penerapan media jejaring sosial facebook pada matakuliah termodinamika exacta 7 2 49 55 1412 3617 analisis kinerja keuangan pemerintah daerah kabupaten induk kabupaten pemekaran pasca pemekaran wilayah kasus pada kabupaten propinsi bengkulu pelaksanaan ganti rugi hak milik atas tanah pengadaan pembangunan kepentingan umum menurut perpres nomor 36 tahun 2005 jo perpres nomor 65 tahun 2006 kelurahan pasar bengkulu kecamatan sungai serut campur kode proses belajar mengajar mata pelajaran bahasa indonesia smp n 1 curup utara solution of knapsack constrained maximum spanning treee problem using kruskal algorithm bilangan ramsey 2 2 12 penerapan teori belajar gagne dengan strategi motivasi arcs meningkatkan hasil belajar matematika siswa kelas vii smp pesantren pancasila kota bengkulu analisa kinerja keuangan terhadap pertumbuhan ekonomi pengangguran kemisikinan analisis regresi linier berganda dengan prosedur doo little penerapan model pembelajaran rekreatif teknik kuis kimia dengan media powerpoint meningkatkan hasil belajar berpikir kreatif siswa sma 5 bengkulu selatan tdn total digestibel nutrient mikania mikania micrantha dengan rumput lapang konsentrat pada kambing kacang jantan pelaksanaan pembelajaran drama sma negeri 1 curup kota tahun ajaran 2009 2010 perbandingan hasil belajar kimia antara penerapan pembelajaran kooperatif tipe jigsaw nht number head together pada pokok bahasan reaksi reduksi oksidasi redoks sma n 5 kota bengkulu status hukum zhihar kifarat ditinjau dari hukum islam proses pengangkatan anak kedudukannya terhadap harta warisan menurut hukum adat pekal kecamatan ketahun kabupaten bengkulu utara partisipasi petani plasma non plasma pembangunan perekonomian desa desa suka negara kecamatan putri hijau kabupaten bengkulu utara ?? upaya meningkatkan hasil belajar kimia siswa sman 3 kota bengkulu dengan penerapan model pembelajaran interaktif menggunakan metode cpdt ceramah plus diskusi tugas partisipasi petani plasma non plasma pembangunan perekonomian desa desa suka negara kecamatan putri hijau kabupaten bengkulu utara simulasi gerak osilasi pada pegas dengan menggunakan program easy java simulation ejs analisis perubahan struktur organisasi berdasarkan no 41 lingkungan dinas pendidikan nasional propinsi bengkulu penerapan metode inkuiri terbimbing tipe a menggunakan media powerpoint pada mata kuliah fisika dasar i konsep dinamika partikel mahasiswa semester i ta ganjil 2008 2009 prodi pfisika fkip unib exacta 7 2 56 62 1412 3617 pengaruh konflik terhadap kinerja karyawan pt perkebunan nusantara vii persero kantor distrik bengkulu dampak pemberian uap lem a ic a aibon terhadap jumlah eritrosit leukosit mencit mus musc ulus swiss webster jantan perbandingan hasil belajar biologi antara siswa laki laki siswa perempuan pada pembelajaran kooperatif sman 9 kota bengkulu analisis kinerja koperasi lepp m3 bina masyarakat pesisir kota bengkulu analisis kinerja koperasi lepp m3 bina masyarakat pesisir kota bengkulu analisis kualitas pelayanan servqual pada ruang rawat inap rsud m yunus bengkulu pertimbangan penjatuhan pidana tindak pidana korupsi dibandingkan dengan tindak pidana konvensional kota bengkulu evaluasi sumber daya lahan pengembangan pertanian kecamatan muara bangka hulu korelasi keaktifan bekerjasama pembelajaran kooperatif dengan hasil belajar biologi siswa sman 9 kota bengkulu kajian penggunaan zeolit alam menurunkan kadar fe besi mn mangan derajat warna pada air gambut isolasi steroid dari aquilaria malaccensis uji aktivitas terhadap ph darah maupun kadar glukosa darah mencit mus musculus serta implementasi pada siswa sma balita gizi buruk sebuah potret kemiskinan keluarga kelurahan air bang kecamatan curup tengah kabupaten rejang lebong pengaruh motivasi iklim organisasi penghargaan kejelasan kewenangan terhadap kinerja karyawan kantor bank indonesia bengkulu pengaruh konsep diri minat belajar terhadap hasil belajar matematika siswa smp negeri 2 mukomuko kabupaten mukomuko pengaruh jarak tanam umur pindah bibit terhadap pertumbuhan hasil padi sawah varietas mekongga ahmat rahmat dibawah bimbingan sumardi marulak simarmata 2008 25 halaman pengaruh penerapan manajemen strategi terhadap produktivitas terminal peti kemas bandung akses 6 2 82 91 1693 8356 tinjauan terhadap penggunaan alat bukti berupa informasi elektronik pembuktian perkara pidana analisis jenjang karier karyawan pada pt federal international finance fif cabang bengkulu pembelajaran kontekstual meningkatkan motivasi ketuntasan belajar matematika siswa kelas viii smp negeri 8 bengkulu perbedaan motivasi ekstrinsik antara pns dengan pegawai bumn interest 12 1 40 48 1410 8828 pola konsumsi masyarakat kota bengkulu interest 12 2 1 7 1410 8828 kajian perubahan kualitas minyak goreng kelapa sawit selama proses pemanasan responsibility of teachers on task of teaching learning a study of descriptive qualitative at yunior high school number 2 lubuk pinang and yunior high school number 3 mukomuko utara kajian yuridis pengangkatan wali oleh panti asuhan bunga harapan kota bengkulu persepsi siswa kelas vll vlll sbi smp negeri 1 kota bengkulu terhadap guru proses belajar mengajar bahasa indonesia kelas pengaruh pemberian getah buah pepaya carica papaya linn kemampuan reproduksi mencit mus musculus balb c betina pendapat hakim pengadilan agama klas ia bengkulu terhadap nikahul fasid ditinjau dari undang undang nomor 1 tahun 1974 peningkatan kualitas pembelajaran kimia melalui model advance organizer dengan metode eksperimen pada pokok bahasan kelarutan hasil kali kelarutan sma negeri 6 kota bengkulu pengembangan instrumen penilaian berbasis kelas aspek berbicara mata pelajaran bahasa indonesia smp kelas vii pengaturan tugas pokok fungsi antar dinas pengelolaan pasar minggu kota bengkulu karakteristik fisik biji fisiologis benih surian toona sureni merr provenan desa batu bandung kecamatan muara kemumu kabupaten kepahiang perbandingan hasil belajar matematika antara pembelajaran menggunakan model belajar penemuan dari bruner dengan pembelajaran konvensional smp negeri 1 pondok kelapa analisis fairness incentive contracting pada kinerja berbasis anggaran pengujian eksperimen atas referent cognition theory network marketing system pada pt k link indonesia ditinjau dari hukum islam manajemen kelas berbasis kesiswaan meningkatkan kreativitas siswa pembelajaran kelas pengaruh orientasi profesional lingkungan pengendalian organisasi terhadap konflik peran kepuasan kerja kinerja penggunaan transistor 2n3055 pada pembuatan sel surya sederhana berbasis bahan semikonduktor pengaruh kepuasan kerja terhadap kinerja aparat pemerintah daerah dengan self esteem self efficacy sebagai variabel intervening analisis ilmu berawal dari bacaan analisis tingkat kualitas pelayanan jasa dengan metode six sigma pada usaha jasa service motor kasus bengkel mertha buana ahass 7342 mekanisme program bantuan kesejahteraan sosial permanen bksp pemenuhan kebutuhan lanjut usia terlantar kasus pada kepengurusan bksp lansia terlantar penerima program bksp yang dilaksanakan yayasan pelita hati kota bengkulu peran bagian pemasaran sebagai public relations membentuk citra positif hotel analisis validitas isi soal ujian nasional mata pelajaran bahasa indonesia sekolah menengah atas madrasyah aliyah sma ma tahun pelajaran 2008 2009 penilaian kesehatan tanah mineral gambut kota dengan pendekatan indikator kinerja tanah in kongres himpunan ilmu tanah seminar ilmu tanah 20 22 november 2009 yogyakarta unpublished laporan kegiatan penelitian hibah penelitian strategis nasional tahun 2009 penilaian kesuburan kesehatan tanah dengan pendekatan indikator kinerja tanah bioassay tanaman project report lembaga penelitian universitas bengkulu universitas bengkulu penggunaan peta kesuburan kesehatan tanah pertanian berkelanjutan in konggres himpunan ilmu tanah seminar ilmu tanah 20 22 november 2009 yogyakarta unpublished tinjauan yuridis eksistensi pengadilan hak asasi manusia indonesia analisis pengaruh secara simultan struktur kepemilikan kebijakan keuangan nilai perusahaan analisis pinjaman daerah sebagai alternatif sumber dana pembangunan program tahun jamak provinsi bengkulu tahun 2007 2009 ekonomi perencanaan pembangunan 2 2 1 8 1979 7338 analisis utang luar negeri pemerintah terhadap pertumbuhan ekonomi indonesia periode 2000 2008 peningkatan pengelolaan sarana prasarana sekolah melalui pendampingan kepada petugas penelitian tindakan sekolah menengah atas negeri 1 argamakmur kabupaten bengkulu utara manajemen pembelajaran paud deskriptif kualitatif pada kelompok bermain paud sredtta kota bengkulu analisis kinerja pengurus koperasi suka mulya desa rawasari kecamatan seluma timur kabupaten seluma optimalisasi jalur penerbangan indonesia dengan menggunakan algoritma semut analisis kualitas operasi jasa kesehatan pada puskesmas sukamerindu penetapan standar waktu proses produksi pakaian seragam sd study kasus toko rosa taylor manna dengan toko busana dasar hukum pertimbangan hakim pengadilan agama menentukan hak asuh anak bawah umur akibat terjadinya perceraian kota bengkulu faktor faktor yang mempengaruhi pendapatan usaha sektor informal sekitar kampus universitas bengkulu perjanjian novasi sebagai salah satu upaya penyelesaian kredit macet pengaruh konsentrasi ekstrak umbi dewa gynura pseudochina lour dc sebagai antikoagulan pada darah manusia evaluasi pelaksanaan anggaran pendapatan belanja daerah pemerintah provinsi bengkulu tahun anggaran 2004 2005 2006 pelaksanaan supervisi pengajaran oleh kepala sekolah meningkatkan profesionalitas guru deskriptif kualitatif sekolah menengah atas persatuan guru republik indonesia 1 lubuklinggau sekolah menengah atas muhammadiyah 1 lubuklinggau sekolah menengah atas bakti keluarga lubuklinggau analisis program siaran yang mempengaruhi kepuasan pendengar radio swaraunib 99 2 fm pada mahasiswa universitas bengkulu kajian implementasi permendagri nomor 59 tahun 2007 pengelolaan apbd pemerintah provinsi bengkulu analisis variabel variabel yang mempengaruhi struktur modal pada industri makanan minuman foods and beverages bursa efek indonesia seleksi mutan iradiasi sinar gamma rangka perakitan kultivar unggul jagung tenggang kemasaman project report fakultas pertanian universitas bengkulu unpublished topik pilihan biologi perkembangan hewan in topik pilihan biologi perkembangan hewan unib press bengkulu 1 7 978 9799431 49 3 analisis anatomi vertebrae diskus inetrveteralis bagian lumbal pada penyandang perawakan pendek spondylo epiphyseal dysplasia tarda sedt dirsud m yunus bengkulu in seminar nasional biologi ilmu lingkungan pembelajarannya 4 juli 2009 universitas negeri yogyakarta faktor faktor penyebab keberadaan anak jalanan kota bengkulu kasus jalan soeprapto kota bengkulu pertanggungjawaban pers terhadap pemberitaan yang merugikan nama baik orang lain ditinjau dari perspektif hukum pidana perbandingan antara pembelajaran matematika menggunakan pendekatan inkuiri pembelajaran secara konvensional kelas vii smp negeri 21 kota bengkulu tahun ajaran 2008 2009 manajemen pembelajaran rangka memperbaiki mutu perkuliahan penilaian sifat biologi tanah bekas tambang batubara pada tiga tanaman reklamasi analisis fungsi peralatan kantor menunjang pelayanan publik pada pt pln persero rayon nusa indah kota bengkulu analisi faktor faktor yang mempengaruhi perkembangan bisnis ritel kota bengkuluditinjau dari persepsi mahasiswa fakultas ekonomi universitas bengkulu opinion leaders serta implikasinya terhadap strategi pemasaran pemecahan berkas perkara splitsing oleh penuntut umum kaitannya dengan pembuktian wilayah hukum pengadilan negeri bengkulu preferensi terhadap multi atribut belanja tiket pesawat online dikalangan pegawai pemerintah propinsi bengkulu tinjauan yuridis terhadap pengguguran kandungan menurut kuhp undang undang nomor 23 tahun 1992 tentang kesehatan the analysis of monetary policy transmission mechanism effectiveness to indonesia economic growth analisis persepsi masyarakat terhadap kualitas jasa publik problem solving based classroom to improve the quality of teaching and learning processes and student s math achievement action research at state junior high school number 1 of lubuklinggau ies sulit english guru mengajar berdasarkan pendidikan unit kurikulum sebuah penelitian public senior high school kota bengkulu sistem kehadiran otomatis pengunjung perpustakaan menggunakan radio frequency identification rfid penerapan pembelajaran mathematics in context mic meningkatkan hasil belajar matematika siswa smp negeri 21 kota bengkulu kajian pemanfaatan minyak limbah cair industri cpo menjadi biodiesel analisis kepuasan konsumen atas jasa pangkas rambut abas pasar minggu bengkulu implementasi undang undang hak cipta pembayaran royalti hak penampilan pada tempat hiburan karaoke kota bengkulu analisis perbedaan indikator indikator kinerja keuangan perusahaan penguntung pengrugi bursa efek indonesia strategi memperkenalkan sebuah pelajaran baru bekas oleh guru bahasa inggris smkn 3 kota bengkulu pelaksanaan kewenangan camat penyelenggaraan pemerintahan kecamatan sungai serut kota bengkulu beberapa sifat fisik organoleptik sosis nikumi kerbau dengan penggunaan binder tepung kedelai sebagai subtitusi susu skim analisis pengaruh dividend payout ratio dpr return on equity roe return on asset roa terhadap price earning ratio pada perusahaan lq 45 bursa efek indonesia tinjauan kualitas layanan pada pasien rumah sakit jiwa ketergantungan obat soeprapto daerah bengkulu pelaksanaan perjanjian tukar menukar tanah menurut hukum adat kaur kecamatan kaur selatan kabupaten kaur penentuan persediaan pengaman safety stock analisis nilai tambah tepung tapioka ptbumi sari prima kota pematang siantar sumatera utara upaya kepala keluarga bekerja sektor informal memenuhi kebutuhan pendidikan anak pemanfaatan ekstrak biji buah pinang kulit buah delima daun suji sebagai pewarna alami terhadap pewarnaan kulit kayu lantung artocarpus elasticus pengaruh pendidikan latihan serta penempatan terhadap kepuasan kerja karyawan pada pt bara indah lestari bengkulu aplikasi pemrograman dinamis pada penjadwalan mata kuliah dengan pendekatan integer knapsack arakterisasi biodiesel campuran sebagai hasil reaksi transesterifikasi dari limbah cair pengolahan cpo crude palm oil serta implementasinya sman 3 kota bengkulu upaya meningkatkan hasil belajar kimia siswa melalui model pakem pembelajaran aktif kreaktif efektif menyenangkan kelas xb sman 4 kota bengkulu analisis perubahan penggunaan modal kerja terhadap rentabilitas perusahaan pt hanjaya mandala sompoerna tbk pemanfaatan kitin kitosan dari cangkang kepiting mengadsorpsi amoniak model limbah cair industri tahu manajemen musyawarah guru mata pelajaran pendidikan jasmani kesehatan sekolah dasar perbandingan antara kecamatan arga makmur dengan kecamatan padang jaya kabupaten bengkulu utara analisis partisipasi masyarakat pengembangan kawasan kota bintuhan kabupaten kaur analisis karakteristik sedimentasi waduk plta tes sebagai usaha awal perencanaan penanggulangan pengaruh pemberian kasein susu kambing terhadap kadar gula darah mencit mus musculus persepsi dokter keluarga pasien miskin terhadap euthanasia provinsi bengkulu hubungan antara kebermaknaan cara belajar dengan hasil belajar biologi pada siswa sman 6 kota bengkulu penggunaan social networking website facebook pada pembelajaran kimia kelas xi ipa sman 5 kota bengkulu pengaruh penambahan getah damar batu agathis alba pada campuran asphalt concrete binder course ac bc meningkatkan prestasi belajar melalui penerapan model pembelajaran tematik berbasis kelas pada siswa kelas iia sd negeri 19 kota bengkulu analisis sistem kearsipan pada bagian pendidikan kerjasama universitas bengkulu persepsi ulama kota bengkulu terhadap harta waris al kalalah menurut hukum waris islam tanggung jawab para pihak perjanjian sewa alat berat dinas pu provinsi bengkulu analisis peningkatan atau penurunan pembayaran dividen terhadap reaksi pasar pada perusahaan yang listed bursa efek indonesia pengaruh faktor situasional pada pembelian durable nondurable goods pengaruh economic value added eva terhadap return saham industri farmasi yang listed bursa efek indonesia bei manajemen disiplin kerja dosen sekolah tinggi manajemen ilmu komputer stmik musi rawas kota lubuk linggau evaluasi tingkat kin evaluasi tingkat kinerja jalan kota bengkulu kasus jalan wr supratman jalan kalimantan jalan danau kasus jalan wr supratman jalan kalimantan jalan danau kasus jalan wr supratman jalan karakteristik konsumen rokok class mild kota bengkulu analisis pengaruh prestasi kerja expos u re kesetiaan organisasional mentor kesempatan tumbuh terhadap pengembangan karier pegawai lingkungan badan kepegawaian daerah provinsi bengkulu perbedaan prekuensi aktifitas siswa hasil belajar siswa dengan menggunakan model pembelajaran kooperatif tipe stad berbantuan media vcd tanpa vcd kelas viii smp negeri 2 kota bengkulu analisis implementasi pengukuran kinerja pada aspek keselarasan antara kebijakan pemerintah daerah dengan kebijakan pemerintah kasus evaluasi kinerja penyelenggaraan pemerintahan daerah ekppd kota bengkulu tahun 2007 korelasi antara sifat sifat tanah dengan hasil cabai merah pada substitusi pupuk n anorganik dengan bokasi tusuk konde wedelia trilobata l akta agrosia 12 2 184 194 1410 3354 upaya meningkatkan aktivitas hasil belajar kimia siswa melalui penerapan model pembelajaran arias assurance relevance interest assessment and satisfaction system study of nursery school country builder 2 bengkulu city identifikasi tubuh buah jamur pada area terserang patogen busuk akar pertanaman acacia mangium willd hubungan antara kepangkatan kepuasan kerja guru smu negeri se kota kediri triadik 12 1 71 77 8053 8301 verifikasi conjecture reed graph mycielski pengaruh ekstrak daun katuk minyak ikan lemuru plus vitamin e terhadap kolesterol lemak komposisi asam lemak telur ayam ras coklat analisis kepuasan nasabah terhadap kualitas pelayanan jasa asuransi pada pt asuransi jiwa bumi asih distrik bengkulu herbicide combination for controlling glyphosate resistant weed akta agrosia 12 1 83 88 1410 3354 pengaruh kompensasi kemampuan karyawan terhadap kinerja karyawan pt varia intra finance vif cabang bengkulu analisis kontrak kerjasama antara pemerintah kota bengkulu dengan cv dwisaha selaras abadi pengelolaan pasar tradisional modern ptm kota bengkulu peranan polisi lalu lintas penanggulangan kecelakaan lalu lintas propinsi kota bengkulu performans reproduksi sapi peranakan ongole po gaduhan kecamatan sukaraja kabupaten seluma upaya taman bacaan masyarakat tbm anraguta rangka menumbuhkan minat baca masyarakat environmental impact analyze of crumb rubber manufactured on kembang seri bengkulu tengah region social economy aspect program bantuan pinjaman langsung masyarakat kabupaten kaur sebuah evaluasi ekonomi perencanaan pembangunan 2 1 1 8 1979 7338 the family diversity of soil arthropods in newly reclaimed coal mined land in central bengkulu jurnal penelitian lembaga penelitian universitas bengkulu 15 1 26 29 0852 405x implementasi kepres nomor 80 tahun 2003 tentang pengadaan barang jasa pemerintah pada paket pelelangan renovasi gedung tatalaksana lpmp bengkulu dampak pemberian uap lem ai ca ai bon terhadap kadar gula darah mencit swiss webster jantan mu s mu scu l u s persepsi konsumen terhadap produk lempuk sari rasa bengkulu strategi pembelajaran konstruktivisme tutor meningkatkan efikasi diri warga belajar program paket c pada pkbm kecamatan gading cempaka kota bengkulu perbandingan antara pengaruh penggunaan musik microsoft daya point sebagai media atas anak kosakata penguasaan a penelitian perbandingan pada mahasiswa tahun ketiga sdit iqra '1 bengkulu 2008 2009 tahun akademik pengaruh komunikasi antara orang tua anak terhadap penyalahgunaan obat terlarang peningkatan hasil belajar menulis bahasa petunjuk pembelajaran bahasa indonesia melalui strategi snowball throwing pada siswa kelas viii smp negeri 3 padang ulak tanding penelitian tindakan kelas kajian kualtas bahan bakar nabati bbn dari limbah minyak pengolahan kelapa sawit sebagai bahan tambahan minyak tanah akuntabilitas pengelolaan pembelajaran oleh guru pendidikan pancasila kewarganegaraan ppkn evaluasi smp negeri 2 giri mulya kab bengkulu utara peningkatan kualitas sayuran kubis melalui mekanisme pengelolaan tanaman yang ramah lingkungan project report lembaga penelitian universitas bengkulu bengkulu unpublished penerapan metode greedy pada penjadwalan mata kuliah melalui pendekatan integer knapsack analisis neraca air water balance sub das ketahun hulu kabupaten lebong provinsi bengkulu hubungan faktor perilaku pemimpin dengan kinerja pegawai pada kantor pajak pratama modern argamakmur kabupaten bengkulu utara rekayasa teknologi produksi kentang dataran medium bengkulu induksi ketahanan tanaman kentang terhadap cekaman suhu tinggi kekeringan project report lembaga penelitian universitas bengkulu bengkulu penggunaan ejaan bahasa indonesia skripsi mahasiswa program pendidikan luar sekolah fkip unib evaluasi anggaran pendapatan belanja daerah apbd ditinjau dari proses pengalokasian kasus pemerintah kota bengkulu analisa perbedaan pendapatan nelayan yang menerima dengan nelayan yang tidak menerima kredit program pemp kasus kecamatan teluk segara kota bengkulu upaya meningkatkan hasil belajar kimia siswa melalui pendekatan psi personalized system of instruction dengan bantuan tutor sebaya peer tutor kelas xi ipa 2 sma negeri 3 kota bengkulu karakteristik morfologi genetik plasma nutfah jagung lokal bengkulu signifikansi sektor pertanian provinsi bengkulu analisa input output in prosiding semirata bks ptn wilayah barat bidang ilmu pertanian universitas sultan ageng tirtayasa serang banten fakultas pertanian universitas sultan ageng tirtayasa serang banten banten 1 15 978 979 19929 0 9 dampak beberapa opsi kebijakan terhadap pertumbuhan ekonomi provinsi bengkulu analisa input output soca 9 1 88 95 1411 7177 laporan penelitian tahun ke ii kajian tentang local concept ketahanan pangan probabilitas terjadinya kerawanan pangan rumah tangga pada rumah tangga nelayan petani padi kabupaten mukomuko propinsi bengkulu project report lembaga penelitian universitas bengkulu bengkulu pengaruh manajemen kelas dengan pendekatan matematika realistik rme terhadap hasil belajar matematika ditinjau dari motivasi belajar penelitian eksperimen sekolah menengah pertama negeri 3 padang jaya kabupaten bengkulu utara analisis wacana kelas taman kanak kanak tk dengan metode dialog interaktif tk islam terpadu tk it aula duna kota bengkulu the analysis of income experience in farming and orange farmers perception in changing orange farming to oil palm farming kajian terhadap manajemen pembelajaran taman kanak kanak tk analisis produktivitas produksi amdk air minum kemasan pada pt sembilan pilar utama bengkulu prediksi erosi peda aliran sungai serut bengkulu dengan metode usle penerapan model pembelajaran kooperatif tipe investigasi kelompok pada pembelajaran matematika kelas vii smp negeri 9 kota bengkulu perencanaan tata ruang wilayah perbatasan kabupaten kota berdasarkan undang undang nomor 26 tahun 2007 tentang penataan ruang kinerja temulawak c xanthorriza roxb tabut blok konsentrat terhadap produksi susu lemak susu ruminansia laktasi jurnal toi 2 2 60 66 1979 892x produksi susu lemak susu kambing peranakan ettawa dengan pemberian pasta tapai temulawak curcuma xanthorriza roxb in prosiding semirata bks ptn wilayah barat bidang ilmu pertanian universitas sultan ageng tirtayasa banten universitas sultan ageng tirtayasa serang banten serang banten 1 7 978 979 19929 0 9 pengaruh lingkungan kerja motivasi terhadap kinerja pegawai dilingkungan pegawai dinas perhubungan komunikasi informasi provinsi bengkulu the analysis of determinant of local government expenditure in bengkulu province pengaruh penambahan variasi jumlah katalis bifungsional terhadap hasil cracking metil ester dari limbah cair pengolahan kelapa sawit implementasinya pada pembelajaran kimia sma desain sistem penakar hujan otomatis menggunakan sensor optik analisa gangguan simpatetik trip oleh ground fault relay menggunakan python 25 pada sistem kelistrikan distribusi primer bengkulu pengaruh pembelajaran fisika dengan metode quantum learning terhadap hasil belajar fisika sma negeri 3 seluma perolehan kemampuan berwirausaha pengusaha lempuk durian kota bengkulu elis sumiati 2009 the correlation between leadership empathy and knowledge on duty and the ability in implementing school headmaster roles as a school manager of kindergarten in bengkulu city hubungan antara empati kepemimpinan pengetahuan terhadap tugas dengan kemampuan melaksanakan peran kepala sekolah sebagai manajer sekolah taman kanak kanak kota bengkulu rancangan acak lengkap dengan subsampel pengaruh konsentrasi alkali aktif sulfiditas terhadap sifat pulp puar amomum maximum auct pengelolaan taman kanak kanak sekolah dasar satu atap perbandingan antara taman kanak kanak sekolah dasar satu atap 06 argamakmur dengan taman kanakkanak sekolah dasar satu atap 07 padang jaya kabupaten bengkulu utara evaluatif kinerja pengawas pendidikan agama islam tk sd mi md kecamatan argamakmur dari departemen agama bengkulu utara effect of lipo chitooligosaccharide on germination and seedling growth of cauliflower akta agrosia 12 1 75 82 1410 3354 problematika kompetensi penulisan karya ilmiah guru sma negeri i curup rejang lebong bengkulu genetic analysis of quantitative traits and self compatibility of sunflower on ultisol akta agrosia 12 1 89 97 1410 3354 pengaruh gaya kepemimpinan lingkungan kerja terhadap motivasi kerja anggota pada organisasi pencinta alam universitas bengkulu komparasi dua tipe perangkap monitoring populasi orong orong gryllotalpa sp areal sawah tadah hujan kecamatan air periukan kabupaten seluma analisis pola pencarian informasi penyuluhan pertanian melalui metode kelompok kasus pada petani padi sawah desa kampung jawa baru kecamatan lebong utara kabupaten lebong analisis perbedaan motivasi intrinsik ekstrinsik terhadap kinerja karyawan pt adira motor cabang bengkulu pengolahan citra iris mata deteksi kolesterol tubuh menggunakan learning vector quantization analisis tingkat ketahanan pangan rumah tangga abk anak buah kapal kecamatan ketahun kabupaten bengkulu utara suplementasi ekstrak akar alang alang imperata cylindrica meningkatkan kualitas karkas pada ayam broiler analisis model antrian pemilih upaya peningkatan kualitas pelayanan pemilihan umum anggota legislatif pada pemilu 2009 pelayanan prima bidang akademik bagi mahasiswa prodi pendidikan bahasa indonesia fkip universitas bengkulu penerapan pendekatan konstruktivisme model pembelajaran kooperatif tipe probing prompting meningkatkan hasil belajar kimia pokok bahasan minyak bumi kelas x siswa man kota manna analisis tingkat kualitas layanan warung internet warnet mitranda bengkulu pengujian galur galur harapan kedelai hasil persilangan varietas malabar kipas putih pada dosis pupuk fosfor p rendah in prosiding semirata bks wilayah barat bidang ilmu pertanian universitas sultan ageng tirtayasa banten 1 9 waktu aplikasi pupuk nitrogen terbaik pertumbuhan hasil kedelai varietas kipas putih galur 13 ed akta agrosia 12 2 204 212 1410 3354 upaya kepala sanggar kegiatan belajar skb meningkatkan kinerja pamong belajar sanggar kegiatan belajar skb kota curup kabupaten rejang lebong kaji eksperimental perbandingan performansi mesin pendingin kompresi uap dengan menggunakan pipa kapiler katup ekspansi teknosia 2 6 34 39 1978 8819 pengendalian persediaan bahan pakan udang menekan biaya poroduksi pada pt cendana prioritas lestari bengkulu utara analisis prisma pasang surut estuari tedunan kecamatan semidang alas maras kabupaten seluma penerapan metode cooperative learning tipe teknik kepala bernomor struktur upayameningkatkan keaktifan prestasi belajar siswa pada mata pelajaran pkn kelas iva sekolah dasar negeri 19 kota bengkulu faktor faktor yang mempengaruhi proses pengembalian kredit nasabah upkd harapan maju pasca proyek brdp bengkulu regional development project penerapan pendekatan kontekstual conteextual teaching and learning dengan model pembelajaran kooperatif tipe jigsaw ii sebagai upaya meningkatkan hasil belajar biologi siswa kelas viii b smp n 2 kota bengkulu persepsi konsumen terhadap kualitas layanan pasti pas pada spbu rawa makmur bengkulu kasus pada kendaraan roda empat ke atas karakteristik kekuatan tanah berdasarkan batas batas atterberg dengan metode casagrande jenis jenis lalat burung liar yang berpotensi menyebarkan virus flu burung kabupaten mukomuko upaya keberhasilan pkbm dellia kota bengkulu penyelenggaraan pendidikan kesetaraan program paket c kota bengkulu perbedaan antara pemberian teknik pemodelan dalamketerampilan berpidato siswa madrasah aliyah negeri man 2 kota bengkulu faktor faktor yang mempengaruhi keinginan berpindah pada guru bantu sekolah dasar kecamatan muara bangkahulu kota bengkulu engaruh profesionalisme auditor terhadap tingkat materialitas pengauditan laporan keuangan kondisi sosial ekonomi wisatawan kota bengkulu the effect of work on reproductive performance of bali cattle under the oil palm plantation in bengkulu in proceesding the 1st international seminar on animal industry faculty of animal science ipb bogor 1 9 978 96530 0 7 analisis pengembangan potensi sekolah menengah atas negeri 7 kota bengkulu korelasi antara posisi kendali internal dengan motivasi belajar kimia pada siswa program ipa sman 5 kota bengkulu tahun ajaran 2009 2010 analisis kompetensi kerja ilmiah siswa pada pembelajaran ipa biologi berbasis masalah lesson study kelas viiic smpn 9 kota bengkulu penentuan harkat permeabilitas tanah batuan daerahrawan gerakan tanah longsor jalur lintas bengkulu kepahiang menggunakan metode falling head permeter kasus jalur lintas bengkulu kepahiang faktor faktor yang berhubungan dengan tingkat motivasi kerja anggota kelompok peternak janur wendo desa bukit sari kecamatan kabawetan kabupaten kepahiang dinamika model pengelolaan populasi ternak kelinci desa karang jaya kabupaten rejang lebong keanekaragaman jenis gulma pada ekosistem sawah kawasan pesisir propinsi bengkulu kemungkinannya sebagai pakan ternak itik project report lembaga penelitian universitas bengkulu unpublished nilai nutrisi gulma sawah dominan kawasan pesisir kota bengkulu peran dewan pendidikan meningkatkan mutu pelayanan pendidikan deskriptif kualitatif kota lubuklinggau pengaruh kinerja keuangan terhadap rate of return pada perusahaan perbankan yang terdaftar bursa efek indonesia evaluasi program pemberdayaan ekonomi masyarakat pesisir ppemp kota bengkulu kasus kecamatan teluk segara analisis profesionalitas tenaga medis memberikan pelayanan kepada masyarakat rsud curup pemanfaatan ekstrak kulit jengkol pithecollobium jiringa daun pacar air impatiens balsamina kulit rambutan nephelium lappaceum sebagai pewarna alami tekstil model pengeringan ikan efek rumah kaca dengan pemanfaatan sumber energi terbarukan project report lembaga penelitian unib unpublished kajian beberapa algoritma dekomposisi lu dari matriks simetris positif definit penyelesaian sistem persamaan linier analisis pengaruh pengumuman dividen tunai cash dividend terhadap harga saham pada perusahaan yang terdaftar bursa efek indonesia bei persepsi stage holder terhadap pengembangan agropolitan kabupaten lebong pengaruh ketrampilan motivasi terhadap kinerja pegawai pada kantor administrasi pelabuhan pulau baai bengkulu analisis metode simplex sebagai algoritma eksponensial selectivity of alachlor herbicide on sweet corn zea mays saccharata l and nutsedge cyperus rotundus l akta agrosia 12 2 130 136 1410 3354 pengaruh return saham volume perdagangan saham varian return saham terhadap bid ask spread saham pada perusahaan yang tergabung indeks lq 45 bursa efek indonesia analisis soal mata pelajaran bahasa indonesia ujian akhir sekolah berstandar nasional tingkat sekolah dasar provinsi bengkulu tahun pelajaran 2007 2008 pertumbuhan stek bonggol pisang ambon curup pada berbagai intensitas naungan dosis kalium upaya penurunan tingkat pencemaran limbah cair pengolahan karet menggunakan zeolit alam dengan sistem batch peranan bidang pendapatan pada dinas pendapatan daerah kabupaten bengkulu selatan pengelolaan pajak daerah selection of high productivity cacao f1 hybrid on seedling phase using descriminant analysis akta agrosia 12 2 106 114 1410 3354 uji daya hasil pendahuluan lanjut hibrida silang ganda double cross berdaya hasil tinggi adaptif pada lahan ultisol dengan dosis pemupukan rendah tanpa pengapuran tanpa bahan organik project report lembaga penelitian unib bengkulu unpublished analisis efektivitas iklan facebook meningkatkan brand awareness perlindungan hukum bagi anak nakal anak delinkuen pada tahap penyidikan ditinjau dari undang undang nomor 3 tahun 1997 tentang pengadilan anak undang undang nomor 23 tahun 2002 tentang perlindungan anak pengaruh perlakuan baris pada sistem tanam legowo terhadap produktivitas pendapatan resiko usahatani padi sawah pengaruh partisipasi anggaran keterlibatan kerja terhadap senjangan anggaran dengan komitmen organisasi sebagai variabel moderasi penampilan keragaman sifat pertumbuhan bibit 11 genotipe kopi tinjauan yuridis penggunaan tanah wakaf kegiatan usaha ekonomi produktif masjid muhammadiyah suprapto kota bengkulu analisis perbedaan perusahaan yang tumbuh tidak tumbuh terhadap kebijakan pendanaan dividen pembagian harta bersama suami istri setelah perceraian menurut hukum adat pasma kecamatan kelam tengah kabupaten kaur analisis pelayanan simpan pinjam pada koperasi unit desa bina warga desa pasar pedati kecamatan pondok kelapa kabupaten bengkulu tengah strategy of commodity holticulture with quality in province bengkulu complied public perception pengaruh mikoriza vesikular arbuskular mva zat pengatur tumbuh terhadap ketersedian serapan p serta pertumbuhan jarak pagar pada lahan alang alang analisis kebijakan redaktur penempatan foto berita harian rakyat bengkulu pembuatan arang aktif dari serbuk gergaji kayu tembesu fragaea fraggrans dengan aktivasi secara fisika kimia menggunakan aktivator asam phospat menyerap ion kromium terlarut air eksistensi kantor pertanahan penyelesaian sengketa pertanahan kabupaten bengkulu utara pengaruh sinetron cookies kumpulan kisah manis terhadap perilaku remaja strategi berjualan komunitas pedagang sayur meningkatkan pendapatan keanekaragaman jenis kelimpahan mamalia besar kawasan stasiun re introduksi orangutan sumatera taman nasional bukit tigapuluh tnbt kabupaten tebo jambi hubungan motivasi orang tua dengan prestasi belajar siswa kelas ii smu yayasan pendidikan budaya bandar lampung triadik 12 1 1 5 8053 8301 analisis partisipasi organisasi sayap partai golkar kota bengkulu persiapan menjelang pemilu 2009 evaluation of several high yield rice varieties in new peat soil rice field in padang pariaman district akta agrosia 12 1 56 61 1410 3354 simbol simbol pada komunitas punk peranan alat bukti keterangan terdakwa penyelesaian perkara pidana dj pengadjlan negeri bengkulu kutei 16 59 69 1412 9639 peningkatan motivasi warga belajar paket b oleh tutor menggunakan lembar kerja pkbm pematang indah pengaruh kebijakan buyback saham saham perusahaan bumn terhadap harga saham analisis yuridis putusan kppu komisi pengawas persaingan usaha tentang praktek persekongkolan tender divestasi kapal tanker pertamina very large crude carrier vlcc putusan kppu nomor 07 kppu l 2004 penerapan model pembelajaran dinamika kelompok group dynamic dengan metode pemecahan masalah problem solving sebagai upaya meningkatkan hasil belajar kimia siswa kelas xi ipa 2 sma negeri 3 kota bengkulu penerapan model pembelajaran dinamika kelompok group dynamic dengan metode pemecahan masalah problem solving sebagai upaya meningkatkan hasil belajar kimia siswa kelas xi ipa 2 sma negeri 3 kota bengkulu tingkat pendapatan faktor faktor yang mempengaruhi produktivitas usahatani padi sawah sistem tanam legowo upaya peningkatan hasil belajar siswa dengan metode pemecahan masalah model sscs searching solving creating sharing pembelajaran fisika konsep cahaya kelas viii 3 smpn 1 kota bengkulu peranan zakat mensejahterakan masyarakat miskin penerima bantuan program kelompok swadaya masyarakat ksm dari pkpu cabang bengkulu kota bengkulu analisis harga pokok produksi pada perusahaan kopi bubuk sari murni kota bengkulu kegagalan jasa perilaku keluhan persepsi risiko persepsi pelanggan yang akan membentuk kesetiaan pelanggan pada perusahaan jasa indonesia survey on line pandangan remaja mengenai virginitas berdasarkan tingkat pendidikan jenis kelamin keterikatan pada nilai norma serta media informasi penentuan koefisien ortogonal polinomial pada taraf perlakuan berjarak tak sama strategy tourism develomen in bengkulu city hubungan kemampuan motivasi keterampilan terhadap kinerja karyawan pada pt telekomunikasi telkom cabang bengkulu implementasi manajemen peningkatan mutu berbasis sekolah perbandingan antara sekolah menengah pertama negeri 3 dengan sekolah menengah pertama negeri 4 kecamatan padang jaya kabupaten bengkulu utara analisis beban pendingin gedung mega mall bengkulu dengan metode cooling load temperature differencial analisis elastisitas struktur modal terhadap rentabilitas modal sendiri kasus pada bmt al amal bengkulu kemampuan membaca menulis bahasa indonesia siswa kelas iii sd negeri 2 pematang tiga kabupaten bengkulu tengah an analysis of the english study program students preferrences on complaint strategies toward their lecturers a study of the english study program students of bengkulu university in the academic years of 2005 2008 analisis kualitas pelayanan transjakarta koridor iii rute kali deres harmoni pasar baru aplikasi quality function deployment pengaruh pemberian getah buah pepaya carica papaya l terhadap pertumbuhan tulang ekstremitas fetus mencit mus muculus balb c pengelolaan basis data statistik penduduk secara terkomputerisasi kasus desa muara simpur kecamatan ulu talo kabupaten seluma perbanyakan tumbuhan inang rafflesia tetrastigma sp dengan cara stek sebagai media pembelajaran biologi smp pada pokok bahasan perkembangbiakan tumbuhan efektifitas manajemen kurikulum tingkat satuan pendidikan ktsp evaluatif smp negeri 4 arga makmur implementasi kurikulum tingkat satuan pendidikan ktsp perbandingan antara sekolah luar biasa argamakmur bengkulu utara dengan sekolah luar biasa karabela bengkulu peningkatan daya serap materi evaluasi pendidikan dengan latihan terbimbing pada program pls fkip unib triadik 12 1 63 70 8053 8301 penerapan model pembelajaran kooperatif tipe numbered head together nht sebagai upaya memperbaiki proses hasil belajar biologi siswa kelas xi ipa3 sman 1 kota bengkulu perilaku sosial masyarakat dusun iii talang pauh mengkonsumsi air terkait diare balita gaya bahasa novel ketika cinta bertasbih karya habiburrahman el shirazy kasus daya dukung lingkungan desa desa sekitar twa bukit kaba kabupaten rejang lebong tinjauan secara ekologi ekonomi penerapan model pembelajaran kooperatif tipe numbered heads together nht meningkatkan hasil belajar matematika siswa kelas x sma n 3 kota bengkulu perlindungan hukum terhadap anak isteri akibat perkawinan bawah tangan kecamatan teluk segara kota bengkulu kajian penggunaan arang aktif sebagai penyerap fe mn warna air gambut tinjauan kriminologi terhadap tindak pidana penggelapan kendaraan bermotor kota bengkulu pengaruh budaya organisasi motivasi terhadap kinerja pegawai kantor pertanahan kota bengkulu evaluasi terhadap kinerja pengawas sekolah melaksanakan supervisi akademis administratif kecamatan air napal penerapan pembelajaran kooperatif tipe team games tournament tgt dengan pembelajaran model siklus 5e meningkatkan hasil belajar siswa kelas x mata pelajaran kimia sma plus n 7 bengkulu penerapan pembelajaran kimia dengan menggunakan social networking website blogspot sma negeri 6 kota bengkulu peranan pendamping kelompok usaha bersama kube pemberdayaan fakir miskin pemanfaatan bahan organik bakteri pereduksi sulfat remediasi air asam tambang 1 film perempuan berkalung sorban representasi ideologi patriarki sebuah analisis wacana kritis semiotika analisis penyerapan tenaga kerja pada sektor usaha kecil menengah ukm provinsi bengkulu analisis kinerja keuangan daerah provinsi bengkulu periode 2002 2007 biodiversty conservation in indonesia requires religious foundation konservasi hayati 5 1 81 84 0216 9487 faktor demografi computer anxiety keahlian dosen menggunakan komputer ringkasan persepsi konsumen memilih produk bola lampu merek philips penerapan pembelajaran tematik dengan teknik think pair share meningkatkan prestasi belajar siswa kelas ii sekolah dasar negeri 17 kota bengkulu analisis kemampuan mahasiswa praktek pengalaman lapangan program pendidikan biologi persiapan proses pembelajaran bilangan k domination ik bilangan k independent bk pada graph 2 tree analisis kepuasan konsumen terhadap produk kesehatan pt k link indonesia kota bengkulu analisis parameter gempa bengkulu pola sebarannya berdasarkan data rekaman single station bmkg kepahiang propinsi bengkulu pen lingk ngemba kungan seko olah d angan n pesisi dasar s bahan ir untu sd k n ajar b uk sisw kota be berbas wa kela engkul sis as iv lu strategi pengembangan sekolah bertaraf internasional deskriptif kualitatif smp negeri 1 kota bengkulu penguasaan bahasa inggris guru 'dari contextual teaching and learning approach sekolah smp publik gading cempaka kota bengkulu district the school development planning strategic to develop teacher quality in sma negeri 2 lubuklinggau city kedudukan waris anak inseminasi buatan ditinjau dari hukum perdata hukum islam penggunaan gula kelapa sebagai bahan pensubstitusi gula putih pembuatan serbuk effervescent jahe merah terhadap tingkat kesukaan konsumen pola asuh orang tua tunggal mendidik anak usia dini pola asuh anak balita pada taman penitipan anak melati dharma wanita persatuan provinsi bengkulu pelaksanaan program paket b dinas pendidikan nasional kota lubuklinggau penelitian deskriptif kualitatif pada pusat kegiatan belajar masyarakat sumber ilmu kualitas pupuk organik hasil dekomposisi beberapa bahan organik dengan dekomposernya akta agrosia 12 1 1 7 1410 3354 aplikasi analisis ketahanan pada data anak putus sekolah application of survival analysis on the data of drop out students triadik 12 1 79 92 8053 8301 pengaruh tayangan kiss vaganza indosiar terhadap minat penonton career success orientation pegawai negeri sipil pada sekretariat pemerintah kota bengkulu pol a pe ny elesaian kredit macet perjanjian kemitraan antara unit pkbl pt pos indonesia persero dengan kelompok usaha kecil tri karya sejahtera desa kuro tidur kecamatan argamakmur bengkulu utara tanggap galur galur harapan kedelai hasil persilangan varietas malabar kipas putih terhadap dosis pupuk fosfor p rendah fosfor p sedang pengaruh pendidikan latihan serta penempatan terhadap kepuasan kerja karyawan pada pt bara indah lestari bengkulu analisis brand image melalui pengukuran brand awareness perceived quality brand loyalty brand association dari produk pelembab merek pond s analysis brand image through measurement of brand awareness perceived quality brand loyalty and brand association from product moisturizer pond's brand analisis pengelolaan dana bank dengan pendekatan pemrograman dinamis kajian morfologi struktur kulit biji raflesia dengan metode sem tahun pertama project report lembaga penelitian universitas bengkulu unpublished upaya meningkatkan hasil menulis karangan eksposisi dengan model pembelajaran team games tournament tgt pada mata pelajaran bahasa indonesia kelas va sd negeri 69 kota bengkulu the implementation of cooperative classroom analisis kemampuan mekanisme corporate governance memprediksi financial distress analisis faktor penyebab bentuk kekerasan orang tua pada anak keluarga pertumbuhan hasil kultivar padi gogo lokal pada tanah ultisol dengan menggunakan beberapa amelioran keragaman genetik heritabilitas lima aksesi bunga matahari kota bengkulu strategi keunggulan bersaing toko citra rasa menjual makanan khas bengkulu penampilan padi gogo varietas sirantau seladang musi remas akibat radiasi sinar gamma pengaruh penggunaan ekstrak daun katuk sauropus androgynus pada suhu ekstraksi yang berbeda sebagai pengganti feed additive komersial terhadap kualitas karkas broiler pemetaan segmentasi konsumen pemasaran produk perbankan syariah kasus pada pt bank perkreditan rakyat syariah safir bengkulu pengujian fenomena monday effect week four effect rogalski effect pada return saham bursa efek indonesia laporan penelitian kajian keragaan program pemberdayaan ekonomi masyarakat pesisir kota bengkulu project report lembaga penelitian universitas bengkulu bengkulu pengaruh teknologi informasi yang terintegrasi terhadap kinerja perusahaan patogenisitas nematoda steinernema dari tanah pada ekosistem tanaman semusim bengkulu utara terhadap crocidolomia pavonana f analisis hak jawab humas menaggapi berita surat kabar menigkatkan citra pemda penerapan metode geolistrik tahanan jenis sounding menduga struktur bawah permukaan daerah prospek panas bumi gunungapi hulu lais bagian utara analisis pola basantara pada karangan narasi siswa kelas vi sekolah dasar negeri no 8 bengkulu tahun ajaran 2008 2009 penerapan model pembelajaran role playing dengan metode sosiodrama meningkatkan keaktifan prestasi belajar siswa pada pembelajaran tematik kelas iiib sd n 07 kota bengkulu perlindungan anak dari orang tua yang bercerai penerapan model pembelajaran arias dengan metode problem solving meningkatkan hasil aktivitas belajar kimia siswa pada pokok bahasan reduksi oksidasi kelas xe sma negeri 6 kota bengkulu classroom action research tanggung jawab wali terhadap pengurusan harta kekayaan anak yang berada bawah perwaliannya kota bengkulu pengaruh lingkungan kerja motivasi terhadap kinerja karyawan pd utama motor bengkulu upaya peningkatan aktivitas hasil belajar siswa dengan menerapkan model kooperatif tipe numbered head together nht dengan metode problem solving kelas x 1 sman 1 lebong utara evaluasi kinerja lembaga pendidikan tinggi dengan pendekatan balanced scorecard kasus pada universitas muhammadiyah bengkulu pengaruh karakteristik individu lingkungan kerja terhadap kinerja pegawai bagian keuangan lingkungan kantor sekretariat pemerintah kota bengkulu kajian pembuatan briket cangkang kelapa sawit tanpa pengarangan this research purpose is to know the influence of domestic investment foreign investment and government policy in economy growth of indonesia peranan ibu panti asuhan pada pelaksanaan pendidikan keluarga membina perilaku anak serunai jurnal pendidikan 5 1 374 378 1907 0691 daya simpan benih jarak pagar pada berbagai kadar air pengembangan bahan ajar bahasa indonesia pada pendidikan kesetaraan paket b setara smp eksistensi kpu kabupaten lebong proses pencalonan anggota dprd kabupaten lebong testing the insecticidal activity of piper retrofractum extract on crocidolomia pavonana and plutella xylostella and its safety to diadegma semiclausum akta agrosia 12 1 35 44 1410 3354 anal dpd r lisis p ri per politic rwaki cal ma ilan b a pem pada arket bengk ilu 20 ting an kulu t 009 nggo terpil ta lih kajian variasi perbandingan medium fermentasi kadar sukrosa pada pembuatan nata de citrus dengan penambahan ekstrak ampas nanas sebagai medium campuran analisis pengaruh mekanisme good corporate governance asimetri informasi terhadap manajemen laba pada perusahaan manufaktur yang terdaftar bursa efek indonesia tahun 2003 2007 penerapan pembelajaran kooperatif tipe investigasi kelompok dengan metode resource based learning meningkatkan prestasi belajar matematika siswa kelas x sman 1 kerkap perbandingan hasil belajar matematika antara sistem belajar tuntas mastery learning melalui pendekatan personalized sistem of instruction psi dengan pembelajaran ekspositori kelas x sma negeri 1 kota bengkulu analisis kontribusi pajak bumi bangunan terhadap apbd kota bengkulu menunjang otonomi daerah manajemen pembangungan ruang kelas baru rkb smp dana imbal swadaya upaya meningkatkan aktivitas hasil belajar kimia melalui penerapan pendekatan interpersonal dengan metode diskusi kelompok kecil pemanfaatan alat pengering energi surya peroses pengeringan sawi asin meningkatkan hasil belajar menulis paragraf deskripsi melalui pemanfaatan sumber belajar berbasis lingkungan pada siswa sekolah menengah atas kelas x sman 6 kota bengkulu respon hibrid tanaman kakao hasil persilangan pa7xuit1 pa7xna34 pa7xna32 terhadap cekaman kekeringan pada fase bibit analisis strategi bauran komunikasi pemasaran ptbank bengkulu memasarkan produk tabungan tabot pengaruh kompensasi motivasi terhadap kinerja guru sma negeri 2 argamakmur bengkulu utara triadik 13 1 33 42 8053 8301 atribut rumah tangga probabilitas terjadinya kerawanan pangan rumah tangga kabupaten muko muko in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian perguruan tinggi negeri wilayah barat badan penerbitan fakultas pertanian universitas bengkulu bengkulu 696 704 978 602 96609 9 9 inovasi sains teknologi unit penerbitan fkip unib bengkulu 978 602 8043 11 3 peran unit pelaksana teknis daerah sanggar kegiatan belajar uptd skb meningkatkan keterampilan masyarakat pada kelurahan tes kec lebong selatan kab lebong persepsi pegawai tentang daftar penilaian pelaksanaan pekerjaan pegawai negeri sipil kecamatan seluma barat kabupaten seluma strategi komunikasi pemasaran pt pos cabang bengkulu memasarkan produk pos express pemberdayaan usaha ekonomi produktif uep terhadap peningkatan taraf hidup penyandang cacat tubuh kasus pada uep dampingan dinas sosial kota bengkulu pengaruh daya tarik acara obral malam obrolan malam radio kharisma ratu samban fm 95 60 mhz argamakmur terhadap minat dengar kasus pada mahasiswa universitas ratu samban jurusan ilmu komunikasi arga makmur upaya kepala desa meningkatkan partisipasi masyarakat pembangunan infrastruktur kecamatan sukaraja kabupaten seluma pesan pendidikan novel laskar pelangi kajian analisis isi teks novel laskar pelangi karya andrea hirata pengaruh komunikasi antarpribadi sales officer so terhadap peningkatan peminjaman semm pt bank danamon cabang manna bengkulu selatan analisis faktor faktor pembentuk citra kandidat calon gubernur wakil gubernur pada pilkada tahun 2010 provinsi bengkulu pada masyarakat kecamatan bingin kuning kabupaten lebong provinsi bengkulu efektivitas pelaksanaan penguatan kelembagaan kelompok swadaya masyarakat perumahan ksm p penerima program bantuan recovery kasus kelurahan bentiring permai kecamatan muara bangkahulu kota bengkulu hubungan antara latar belakang pendidikan motivasi kerja terhadap efektivitas pelaksanaan tugas pada pt bank tabungan negara persero tbk cabang bengkulu pengelolaan irigasi sawah wilayah sekitar danau dusun besar penelitian kawasan hutan cagar alam dusun besar kota bengkulu strategi political marketing calon incumbent pada pemilukada 2010 kabupaten seluma pemberian asi eksklusif oleh perempuan pekerja sektor publik penelitian kelurahan cempaka permai kecamatan gading cempaka bengkulu strategi pks melakukan pendidikan politik pada kader pada dewan pimpinan daerah partai keadilan sejahtera kota bengkulu faktor faktor komunikasi antar pribadi yang berhubungan dengan konsep diri narapidana resedivis kasus pada petugas rumah tahanan negara kelas iib manna bengkulu selatan analisis ormas lsm pembinaan badan kesbangpol linmas kota bengkulu efektivitas pelayanan publik bidang pemerintahan pada kantor kecamatan sungai serut pria metroseksual rubrik man manual majalah wanita cosmopolitan indonesia edisi maret 2009 semiotika struktural roland barthes peran perum pegadaian meningkatkan pelayanan penyaluran uang pinjaman kepada masyarakat perum pegadaian unit pembantu cabang kembang seri kecamatan talang empat kabupaten bengkulu tengah konflik tapal batas kabupaten bengkulu utara dengan kabupaten lebong konsekuensi pemekaran wilayah provinsi bengkulu etos kerja nelayan kelurahan pondok besi kecamatan teluk segara kota bengkulu analisis kebijakan angkutan batubara propinsi bengkulu analisis framing pemberitaan kontroversi pilkada cabup cawabup kabupaten bengkulu selatan periode 2009 2014 kasus harian rakyat bengkulu berita bulan januari maret 2009 analisis program rehabilitasi penyalahguna narkoba kasus yayasan hidayatul mubtadi ien kota bengkulu analisis kinerja pegawai subbagian rumah tangga universitas bengkulu analisis jaringan komunikasi pendidikan sebaya menyampaikan informasi edukasi kesehatan reproduksi remaja pada jaringan pendidikan sebaya pik krr organisasi sadar sehat reproduksi remaja seroja kota bengkulu analisis proses sosialisasi kultur organisasi meningkatkan komitmen anggota organisasi kultur organisasi unit kegiatan mahasiswa intelectual muslim community fakultas ilmu sosial ilmu politik universitas bengkulu peran masyarakat tepian hutan pelestarian hutan wisata alam bukit kaba pada masyarakat tepian hutan dusun talang markisa desa sumber urip kecamatan selupu rejang kabupaten rejang lebong makna ungkapan ikan sejerek bere secupak madar… aktualisasi kehidupan masyarakat berkas kota bengkulu analisis program pemberdayaan gapoktan oleh dinas pertanian kabupaten seluma desa rawasari kecamatan seluma timur kabupaten seluma pengaruh komunikasi interpersonal motivasi berprestasi diri orientasi nilai hidup terhadap perilaku prestatif mahasiswa penelitian pada mahasiswa jurusan sosiologi universitas bengkulu analisis efektivitas inventarisasi aset daerah pasca pemekaran kasus pasca pemekaran kota lubuklinggau provinsi sumatera selatan komunikasi pemasaran terpadu pt asuransi takaful keluarga cabang bengkulu pemasaran produk asuransi syari ah fulnadi peranan perempuan pemenuhan kebutuhan keluarga kasus perempuan tukang ojek pasar ampera kecamatan pasar manna kabupaten bengkulu selatan komunikasi verbal non verbal dokter pada pasien anak pada dokter rawat inap ruang c2 melati anak rsud dr m yunus bengkulu pengaruh komunikasi interpersonal konselor terhadap sikap korban kekerasan rumah tagga komunikasi interpersonal pada pelaku perceraian perceraian rumah tangga kelurahan panorama kecamatan gading cempaka kota bengkulu eksistensi lembaga sosial jungku pada masyarakat kelurahan bumi agung kecamatan dempo utara kota pagaralam sumatera selatan penerimaan masyarakat terhadap berita politik rbtv khalayak rw 03 kelurahan kandang kecamatan kampung melayu kota bengkulu komunikasi interpersonal orangtua anak tentang komunikasi orangtua anak remajanya yang hamil luar nikah kota bengkulu analisis dampak pertambangan pasir besi terhadap kesejahteraan masyarakat kasus penambangan pasir besi desa penago baru kecamatan ilir talo kabupaten seluma peranan yayasan aisyiyah pemberdayaan wanita rawan sosial ekonomi kasus majelis kesejahteraan sosial yayasan aisyiyah bengkulu performance of gamma irradiated potato cv atlantic and granola grown under medium elevation 600 m asl in bengkulu akta agrosia 13 1 82 88 1410 3354 the effects of n and k fertilization on the growth and yield of taro on dry land akta agrosia 13 1 1 7 1410 3354 penanganan penumpukan sampah sekitar kawasan pemukiman kasus stadion sawah lebar baru kota bengkulu analisis kinerja pengawasan obat makanan kota bengkulu oleh balai pengawas obat makanan bengkulu implementasi peraturan menteri keuangan nomor 22 pmk05 2007 tentang pemberian uang makan pns badan pemberdayaan masyarakat pemerintahan desa bpmpd propinsi bengkulu partisipasi sektor perhotelan mensukseskan program tujuan wisata kota bengkulu penelitian grage horizon hotel bengkulu hubungan antara pelaksanaan program spp simpan pinjam perempuan pnpm mandiri pedesaan dengan kesejahteraan ekonomi masyarakat miskin perempuan pada kelompok spp melati desa kampung baru kecamatan selupu rejang kabupaten rejang lebong pengaruh komunikasi persuasif pementor terhadap peningkatan motivasi belajar siswa aplikasi pada program iiesq siswa muslim sman 6 kota bengkulu solidaritas sosial etnis tionghoa pelaksanaan upacara perkawinan kelahiran kematian kota bengkulu tentang masyarakat keturunan tionghoa kampung cina kelurahan malabero kecamatan teluk segara kota bengkulu konsumsi kosmetik pemutih wajah pada mahasiswi kasus mahasiswi rt08 kelurahan kandang limun kecamatan muara bangkahulu evaluasi pelaksanaan program model desa prima kota bengkulu kasus pada pilot project kelurahan pelaksana program model desa prima kota bengkulu analisis implementasi inpres nomor 3 tahun 2003 tentang kebijakan strategi nasional pengembangan e government pada pemerintah kota bengkulu response of supplementation of blocks made of local ingredients on body weight of bali cattle peranan birokrasi proses pelayanan perizinan investasi kota bengkulu analisis wacana van dijk pada pemberitaan calon gubernur wakil gubernur bengkulu periode 2010 2015 surat kabar harian rakyat bengkulu edisi juni 2010 kendali pasar pemberitaan televisi swasta nasional analisis wacana pada berita politik 3 news room sctv trans tv metro tv konvergensi 1 1 41 46 2086 342x pencitraan berita politik televisi analisis diskursus berita politik sctv trans tv metro tv idea 4 19 1 9 1978 3531 pergeseran paradigma penelitian media massa dari kuantitatif ke kualitatif idea 4 19 44 52 1978 3531 the effect of fresh indigofera leaves utilization as feed supplementation on egg production and its yolk color of ducks pembelajaran inovatif sekolah dasar meningkatkan apresiasi budaya in seminar nasional pendidikan ipa teknologi pendidikan mei 2010 bengkulu pembelajaran terpadu berbasis budaya in pembelajaran terpadu berbasis budaya fkip unib press bengkulu indonesia 1 25 978 602 8043 17 5 unpublished kajian komunikasi kritis terhadap ekonomi politik media idea 4 17 1 4 1978 3531 wacana stigma etnis tionghoa indonesia an nida jurnal komunikasi islam 3 1 53 60 pemanfaatan plasma nutfah kopi arabika lokal sumatra budidaya dataran rendah in seminar nasional field trip pemanfaatan konservasi palsmanutfah unggul lokal 31 juli 1 agustus 2010 padang sidempuan sumatera utara unpublished kajian hambatan komunikasi community development center cdc program pttelkom cabang bengkulu dengan mitra binaan usaha kecil concentration effect of aqueous synthesis on biphasic hydroxyapatite β tricalcium phosphate composition advanced materials research 93 94 405 408 1662 8985 pemberdayaan masyarakat pesisir melalui pemp dampaknya terhadap budaya hukum masyarakat nelayan kota bengkulu yustisia jurnal hukum 21 13 23 0852 0941 program pemberdayaan usaha kecil menengah penyerapan tenaga kerja perindustrian perdagangan kerja dinas koperasi ukm perindustrian perdagangan dinas koperasi ukm perindustrian perdagangan kabupaten kepahiang analisis kualitas pelayanan pembuatan akta kelahiran pada bidang pencatatan sipil analisis persepsi pengunjung tentang penggunaan nilai daya tarik seksual sex appeal iklan poster toko sepatu milano bengkulu pengaruh jaminan sosial tenaga kerja terhadap kinerja karyawan pada karyawan pt karisma utama unit pt pln persero ranting manna bengkulu selatan penerapan pembelajaran kooperatif tipe jigsaw meningkatkan prestasi belajar matematika siswa kelas vi sdn 64 bengkulu selatan dampak pernikahan usia dini desa batu belarik kecamatan bermani ilir kabupaten kepahiang the effects of intrisic motivation extrinsic motivation and perceived ease of use and attitudes s intervening variable on behavior intentions to use computers in the preparation of financial reporting empirical study of skpd of local government in bengkulu in proceedings of the malaysia indonesia international conference on economics motivasi persepsi kemudahan penggunaan niat berperilaku menggunakan komputer penyusunan laporan keuangan pada skpd bengkulu maksi 10 1 36 54 1412 6680 analisis tingkat pengetahuan ibu tentang makanan pendamping air susu ibu mp asi hubungannya dengan status gizi anak usia 6 24 bulan analisis efektivitas program pendidikan gratis lingkungan pemerintah kota bengkulu pembelajaran menyimak yang berkarakter dengan memanfaatkan media sound recorder kultura jurnal bahasa sastra seni 1 2 122 136 2086 0196 bab vii penutup in komunikasi politik politisi pencitraan panggung politik widya padjadjaran bandung 240 242 978 602 8323 49 9 panggung politik komunikasi politik dpr ri periode 1999 2004 dinamika 3 5 1 35 1979 0899x tinjauan kebebasan pers pada redaksi surat kabar harian rakyat bengkulu penggunaan encapsulated ice thermal energy storage pada residential air conditioning menggunakan refrigeran hidrokarbon substitusi r22 yang ramah lingkungan jurnal teknik mesin 7 2 92 98 1829 8958 pendugaan model regresi dengan metode kuadrat terkecil parsial gradien 6 1 537 541 0216 2393 karakteristik arus suhu salinitas perairan pulau enggano pada musim barat in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian ptn wilayah barat badan penerbitan fakultas pertanian unib bengkulu 1107 1112 978 602 96609 9 9 peningkatan produktivitas kedelai genotipe baru melalui teknologi pupuk hayati pemupukan berimbang tanah ultisol project report lembaga penelitian universitas bengkulu aplikasi rhizobium fungi pelarut fosfat rangka meningkatkan serapan hara n p pada beberapa genotip kedelai ultisols in prosiding seminar national rapat tahunan dekan bidang ilmu ilmu pertanian bks ptn wil barat fakultas pertanian universitas bengkulu bengkulu 452 460 978 602 96609 8 2 analisis kepuasan mahasiswa terhadap pemanfaatan stasiun percobaan pertanian spp fakultas pertanian universitas bengkulu perilaku makan burung anak walet putih collocalia fuciphaga dari mulai menetas sampai bisa terbang the comparison of partnership system of broiler farm in pekanbaru city analisis pelayanan jaminan kesehatan masyarakat jamkesmas rumah sakit dr sobirin kabupaten musi rawas strategi komunikasi leader meningkatkan motivasi kerja loyalitas kelompok jaringan multi level marketing strategi optimalisasi pelayanan aparatur dinas kependudukan catatan sipil kab musi rawas propinsi sumatera selatan jurnal ekonomi perencanaan pembangunan 3 2 69 77 1979 7338 efektivitas pelaksanaan penguatan kelembagaan kelompok swadaya masyarakat perumahan ksm p penerima program bantuan recovery analisis koordinasi pelaksanaan pembangunan desa sukamaju kecamatan air periukan kabupaten seluma komunikasi interpersonal para lanjut usia panti werdha mengurangi kesepian analisis kondisi pelaksanaan peran kelompok tani kasus pada kelompok tani rindang harapan desa dusun baru i kecamatan pondok kubang kabupaten bengkulu tengah pengaruh berbagai jenis inang primer terhadap pertumbuhan semai cendana santalum album linn agriculture 18 2 689 697 1412 4262 respon pertumbuhan semai jati putih gmelina arborea roxb dengan pemberian humanure pada tanah kritis percobaan pot rafflesia 15 1 180 186 1411 2434 respon masyarakat terhadap keberadaan pabrik pengolahan karet strategi repositioning program rri daerah bengkulu setelah berstatus sebagai lembaga penyiaran publik isolasi steinernema dari tanah pertanaman jagung bengkulu bagian selatan patogenesitasnya terhadap spodoptera litura f jipi 12 1 34 39 1411 0067 pengembangan model pendidikan nilai pembelajaran bahasa indonesia meningkat kemampuan berpikir reflektif siswa smp triadik 13 1 43 58 8053 8301 the effect of light work on milk production of merino ewes in proceedings international seminar on prospects and challenges of animal production in developing countries in the 21st century ub press malang 44 49 unpublished analisis pesan non verbal antara guru siswa tuna grahita proses belajar slb amal mulia sistem tata kelola database sekolah berbasis web propinsi bengkulu project report lembaga penelitian unib bengkulu unpublished analisis koordinasi dinas pekerjaan umum dpu provinsi dengan badan perencanaan pembangunan daerah bappeda provinsi pembangunan jalan kasus pembangunan jalan akses stq air sebakul perbanyakan bibit bambu secara in vitro melalui modifikasi medium zat pengatur tumbuh project report lembaga penelitian universitas bengkulu bengkulu golongan putih golput pemilu legislatif 2009 kota bengkulu analisis penggunaan acara kucindan basamo oleh masyarakat minang perantauan kota bengkulu mengurangi kerinduan akan ranah minang identifikasi bahan steering knuckle jurnal teknik mesin 7 2 114 117 1829 8958 perancangan kapasitas daya motor belt conveyor 30 ton jam teknomekanik 2 2 164 175 1979 6102 hasil tanaman mentimun pada berbagai jenis mulsa konstruksi ajir in prosiding seminar hortikultura indonesia 2010 perhorti denpasar 239 246 978 979 25 1263 2 promoting growth and tuber formation of potato production at lowland bengkulu by applying anti ga giberellic acid and lowering soil temperatures in proceedings 2nd international conference on biosciences and biotechnology udayana university bali 24 29 978 602 9042 11 5 promoting growth and tuber formation of potato production at lowland bengkulu by applying anti ga gerellic acid and lowering soil temperatures in international conference on biosciences and biotechnology pave the way to a better life 23 24 september 2010 bali pemanfaatan dana bergulir simpan pinjam perempuan spp melalui peran produktif perempuan pesisir efekti implem ivitas pe mentasi p elaksan program add k ta pa naan pem m aloka ahun ang merintah asi dana d ggaran han desa desa kel 2008 a lurahan m n mekanisme program pelatihan sepeda motor balai latihan kerja bengkulu kasus balai latihan kerja bengkulu efektivitas penyuluhan perilaku hidup bersih sehat oleh dinas kesehatan dengan sikap siswa analisis kegiatan sponsorship ptnim cabang bengkulu sebagai strategi komunikasi pemasaran memperkenalkan produk rokok win mild analisis pelayanan sosial melalui sistem panti usaha meningkatkan keberfungsian sosial anak peranan badan lingkungan hidup blh pelaksanaan amdal sebagai salah satu syarat izin usaha propinsi bengkulu interaksi antar pelayan publik pelaksanaan program nasional pemberdayaan masyarakat mandiri perdesaan pnpm mp pemberitaan media cetak kampanye pemilu presiden tahun 2009 akses 7 2 123 139 1693 8356 pendugaan struktur bawah permukaan daerah prospek panas bumi gunungapi hulu lais lereng utara dengan menggunakan metode magnetik flux jurnal ilmiah fisika 7 1 13 23 1829 796x analisis parameter gempa bengkulu berdasarkan data single station multi station serta pola sebarannya berkala fisika 13 4 105 112 1410 9662 analisis karakteristik intensitas curah hujan kota bengkulu flux jurnal ilmiah fisika 7 2 119 129 1829 796x pelaksanaan koordinasi penataan penertiban bangunan wilayah kota bengkulu ketimpangan pembangunan antar kabupaten kota provinsi bengkulu pertumbuhan hasil jagung manis pada pemupukan pergantian berseri vermikompos nitrogen in prosiding seminar nasional hortikultura indonesia 2010 perhimpunan hortikultura indonesia denpasar 319 324 978 979 25 1263 2 pengaruh metode applied behavioral analysis aba terhadap peningkatan kemampuan komunikasi anak autis pola pembagian kerja keluarga buruh perempuan perkebunan teh growth analysis of sweet corn and its correlation to the yield at different rate application of palm oil sludge compost in proceeding international seminar on horticulture to support food security 2010 university of lampung bandar lampung 41 45 978 979 8510 13 7 analisis pelaksanaan program rumah singgah kabahill centre upaya penanggulangan anak jalanan kota bengkulu efektivitas trichoderma sp gliocladium sp pengendalian layu fusarium pada tanaman krisan jipi 12 1 7 12 1411 0067 analisis program pelatihan kerja balai latihan kerja bengkulu perakitan galur padi gogo toleran kekeringan tanah blas berdaya hasil tinggi varietas unggul lokal bengkulu melalui kultur antera project report lembaga penelitian universitas bengkulu unpublished genetic relationship of yam dioscorea sp accessions collected from several regions in java and sumatera island akta agrosia 13 1 55 61 1410 3354 sifat sifat tanah yang berkembang dari bahan volkan halmahera barat maluku utara jipi 12 1 40 48 1411 0067 komunikasi persuasif orang tua mengembalikan kepercayaan diri remaja upaya strategis camat penanganan konflik tapal batas kecamatan giri mulya kabupaten bengkulu utara analisis pelayanan penyaluran kredit usaha kecil menengah oleh bank syariah interpretasi nilai nilai keaktivisan organisasi perspektif interaksi simbolik pada aktivis hmi kammi kota bengkulu the effects of milk production of the javanese thin tail on average daily gain weaning weight and survival of pre weaning lamb interpretasi birefrigence material optik berbasis hibrid tiofena silicon tcnq in seminar nasional penelitian pendidikan penerapan mipa fakultas mipa universitas negeri yogyakarta 15 mei 2010 yogyakarta tata ruang laboratorium ipa in manajemen laboratorium ipa persiapan bagi pendidik mahasiswa laboran ipa unit penerbitan fkip unib bengkulu 1 102 978 602 8043 16 8 the implementation of scaffolding in improving students activeness in writing triadik 13 1 1 18 8053 8301 media cetak yang efektif sosialisasi pnpm mandiri p2kp peranan koperasi wanita citra cempaka pesisir ccp membantu meningkatkan kesejahteraan keluarga nelayan koperasi wanita citra cempaka pesisir ccp kelurahan pasar bengkulu kecamatan sungai serut kota bengkulu penilaian kegiatan sosialisasi penyuluhan pencegahan hiv aids bagi remaja oleh kpa provinsi bengkulu teknik komunikasi persuasif calon gubernur wakil gubernur pada pemberitaan harian rakyat bengkulu edisi juni 2010 analisis pelaksanaan tugas pokok fungsi polisi lalu lintas pada kantor polisi resor bengkulu identifikasi ciri ciri kuantitatif kultivar jagung lokal bengkulu hibrida pada lahan ultisol input rendah in seminar nasional field trip pemanfaatan konservasi palsmanutfah unggul lokal 31 juli 1 agustus 2010 padang sidempuan sumatera utara submitted perakitan varietas jagung hibrida berdaya hasil tinggi adaptif lahan ultisol dengan input rendah in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian fakultas pertanian universitas bengkulu bengkulu 135 138 978 602 96609 8 2 pengaruh daya tarik acara buruan lesitta 101 9 fm bengkulu terhadap minat dengar mahasiswa regenerasi in vitro plantlet pisang ambon curup melalui pembentukan kalus embriogenik in prosiding semirata bidang ilmu ilmu pertanian bks ptn wilayah barat tahun 2010 fakultas pertanian universitas bengkulu bengkulu 468 474 978 602 96609 8 2 stimulasi pertumbuhan immature embryo cemara laut pada beberapa konsentrasi hara makro secara in vitro in prosiding seminar nasional perhorti 2010 fakultas pertanian universitas udayana bali 91 95 978 979 25 1263 2 kultur immature embryo cemara laut casuarina equisetifolia pada beberapa konsentrasi hara makro secara in vitro [experiment] unpublished pengembangan teknologi penyelamatan embrio cemara laut casuarina equisetifolia sebagai upaya pelestarian kawasan konservasi wilayah pesisir kota bengkulu project report lembaga penelitian universitas bengkulu unpublished development of bengkulu local food processing products diversity to support sustainable food security agritech 30 4 256 264 0216 0455 changes in seed quality of mung bean genotypes with different seed characteristics as affected by incubator weathering during maturity stages in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian fakultas pertanian universitas bengkulu bengkulu 68 73 978 602 96609 8 2 effect of substitusion skim milk by soybean meal as binder on physical properties of sausage made from buffallo surimi like kemampuan anggota dewan melaksanakan fungsi pengawasan periode 2004 2009 pengaruh daya tarik iklan paket tagihan tetap ptt televisi gaya hidup terhadap minat beli pelanggan telepon rumah pengaruh kredibilitas consultant oriflame terhadap citra perusahaan strategi kelangsungan hidup keluarga nelayan tradisional pemenuhan kebutuhan pokok kasus pada nelayan tradisional kelurahan malabero kota bengkulu analysis of mother healthy behavior in prevention and dengue treatment marketed surplus ubi jalar ipomoea batatas dampaknya terhadap ketersediaan pangan nonberas provinsi bengkulu in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian perguruan tinggi negeri wilayah barat badan penerbitan fakultas pertanian universitas bengkulu bengkulu 739 748 978 602 96609 9 9 simbol komunikasi upacara ritual tabot hubungan komunikasi administrasi dengan produktivitas kerja pegawai pada dinas pendapatan pengelolaan keuangan aset kota bengkulu analisis pengelolaan barang inventaris dinas pendapatan pengelolaan keuangan aset daerah kabupaten lebong pengaruh menonton film kartun upin ipin terhadap perilaku kesehatan gigi murid sekolah dasar negeri 1 bengkulu analisis peran dinas koperasi pembinaan usaha kecil menengah kabupaten rejang lebong kecamatan curup tengah ascites incidence in broilers analisis penatausahaan keuangan desa pemanfaatan vermikompos produksi biomassa legum penutup tanah inokulum fungi mikoriza arbuskula jipi 12 1 26 33 1411 0067 marketed surplus jagung dampaknya terhadap ketersediaan pangan non beras provinsi bengkulu agrisep 11 2 140 158 1412 8837 laporan hasil penelitian lanjutan tahun ke ii dua kajian komprehensif unit pengelola keuangan desa upkd probabilitas kegagalan pengelolaannya pasca bengkulu regional development project brdp kabupaten bengkulu utara project report lembaga penelitian universitas bengkulu bengkulu analisis implementasi undang undang penyiaran nomor 32 tahun 2002 pada pemberitaan pengemboman mega kuningan program berita liputan 6 stasiun sctv physical and chemical properties for gnetum gnemon and rubber cultivation development in jambi province akta agrosia 13 1 89 97 1410 3354 relations between physical characteristics of land and palm oil production akta agrosia 13 1 35 39 1410 3354 the effect of artificial shade intensity and fertilizer potassium dossage for the growth and yield of big ginger akta agrosia 13 1 62 69 1410 3354 perilaku masyarakat miskin kota bengkulu model pengentasan kemiskinan berbasis nilai sosial budaya lokal project report lembaga penelitian unib unpublished analisis semiotika iklan xl versi orang utan pemaknaan iklan televisi xl versi orang utan nggak usah mikir pada masyarakat kota bengkulu penampilan fisiologi hasil rumput benggala panicum maximum jacq pada tanah salin akibat pemberian pupuk kandang gypsum sumber nitrogen jipi 12 1 61 67 1411 0067 the determinant factors of poverty of fishermen communities in bengkulu city in proceedings of the malaysia indonesia international conference on economics penerapan model pembelajaran investigasi kelompok mpik pada perkuliahan fisika matematika ii exacta 8 2 73 83 1412 3617 agronomical and physiological characters of upland rice grown in soilrice hull media under lower field capacity akta agrosia 13 1 40 49 1410 3354 meningkatkan hasil belajar siswa kelas viii smp negeri 11 bengkulu dengan penerapan pembelajaran kontekstual tutor sebaya in seminar rapat tahunan bidang ilmu mipa semirata bks ptn b universitas riau riau submitted penerapan pendekatan matematika realistik dengan metode proyek mengaktifkan meningkatkan prestasi belajar mahasiswa pada mata kuliah statistik dasar exacta 8 2 44 51 1412 3617 pengaruh assessement terhadap kurikulum matematika penerapan authentic assessment pembelajaran matematika sekolah menengah exacta 8 1 21 29 1412 3617 monitoring oil palm seedling performance in main nursery akta agrosia 13 1 29 34 1410 3354 hubungan komunikasi interpersonal guru dengan peningkatan prestasi belajar siswa sma idhata kota bengkulu analisis dampak penggunaan situs facebook pada remaja usia sekolah identifikasi interpretasi indikator kesehatan tanah in seminar nasional kongres masyarakat konservasi tanah air indonesia mkti 24 25 november 2010 jambi unpublished terak baja bahan amelioran dua mata pisau pertanian in lokakarya nasional pemanfaatan slag pertanian 23 agustus 2010 ipb bogor comparation between soil performance indicator and lettuce performance indicator for determining soil health akta agrosia 13 1 24 28 1410 3354 pembandingan penilaian kesehatan tanah antara indikator kinerja tanah dengan indikator pertumbuhan tanaman selada in international seminar workshop on integrated lowland development and analisis efektivitas majelis latupati pada kebijakan pemerintah daerah ambon pasca terjadinya konflik ambon analisis implementasi prinsip prinsip good governance pengelolaan keuangan daerah in prosiding seminar internasional seminar nasional semirata forum dekan bks ptn wilayah barat indonesia fakultas ekonomi universitas lambung mangkurat banjarmasin 402 416 kompetensi kognitif awal mahasiswa pendidikan fisika fkip universitas bengkulu pada diagram fisika semirata bks ptn wilayah barat bidang mipa 1 7 submitted analisis pelaksanaan jaminan sosial pada buruh pabrik kelapa sawit pt bumi mentari karya bmk desa tunggang kecamatan pondok suguh kabupaten mukomuko provinsi bengkulu seleksi populasi mutan hasil induksi mutasi dengan iradiasi sinar gamma pada anggrek spathoglottis plicata blume asal bengkulu berdasarkan karakter morfologi tanaman project report fakultas pertanian universitas bengkulu unpublished kondisi sosial ekonomi keluarga anak jalanan profil pedagang kaki lima pasca pembangunan pasar tradisional ptm kota bengkulu pola interaksi sosial peladang serawai talang masjid kasus talang masjid kecamatan taba penanjung kabupaten bengkulu tengah keragaan pertumbuhan vegetatif reproduktif hibrida jagung persilangan galur inbrida mutan m4 pada latosol darmaga jipi 12 1 55 60 1411 0067 bab i pendahuluan in model teratoproteomik penerapan teknik analisis protein penelitian bidang toksikologi perkembangan unib press bengkulu 1 7 978 979 9431 45 5 integrating the message of turtle conservation into a science teaching plan for elementary school in bengkulu city indonesia asian turtle conservation network laporan penelitian unggulan pengembangan potensi kulit batang gaharu aquilaria malaccensis sebagai penambah kebugaran seksual melalui uji fertilitas teratogenesis ekstrak steroid pada mencit mus muculus project report lembaga penelitian universitas bengkulu bengkulu laporan penelitian unggulan unib pengembangan tumbuhan betadin jatropa multifida l meningkatkan jumlah trombosit keping darah pada penderita penyakit demam berdarah dengue project report lembaga penelitian universitas bengkulu bengkulu characterisation of mutation of the sedl trappc2 gene in patiens with x linked spondyloepiphyseal dysplasia tarda from a region of indonesia in seminar hasil par 5 oktober 2010 hotel millenium jakarta increasing index by using calliandra leaves meals calliandra callothyrsus and shrimp head meals in duck diets perbaikan struktur tanah pada lahan sangat curam dengan menggunakan teknik hidrosiding lumut daun bahan pembenah tanah jipi 12 1 1 6 1411 0067 penerapan paket program pendidikan berwawasan keterampilan hidup life skills berbasis potensi daerah bagi siswa sma propinsi bengkulu triadik 13 1 19 32 8053 8301 deskriptif faktor penyebab lanjut usia menjadi warga balai pelayanan penyantunan lanjut usia propinsi bengkulu pemaknaan pesan pergeseran nilai pada adat perkawinan masyarakat kabupaten empat lawang implementasi metode quality function deployment qfd guna meningkatkan kualitas gula kristal putih in prosiding semirata bidang ilmu ilmu pertanian bks ptn wilayah barat tahun 2010 poster fakultas pertanian unib bengkulu 1211 1216 9786029660999 pengaturan populasi tanaman aplikasi tithonia diversifolia sebagai pengganti n sintetik terhadap perubahan sifat kimia ultisol hasil padi gogo agroekologi 28 4 486 493 1412 100x pola pertumbuhan hasil padi gogo yang disubtitusi bahan organik dengan manipulasi jarak tanam agroekologi 26 2 334 340 1412 100x subtitusi tithonia diversifolia modifikasi jarak tanam terhadap pertumbuhan gulma padigogo komponen hasil padi gogo jurnal penelitian lembaga penelitian universitas bengkulu 16 1 64 70 0852 405x tanggap tanaman padi gogo terhadap pengurangan n sintetik yang digantikan dengan bahan organik pupuk kandang tithonia diversifolia agriculture 18 2 710 718 1412 4262 morphological description of upland rice cultivars in bengkulu akta agrosia 13 1 8 15 1410 3354 nitrogen dosage and application time of cytokinin on artemisia annua l a traditional antimalaria herbal akta agrosia 13 1 77 81 1410 3354 analisis status gizi balita kelurahan kuala lempuing kecamatan ratu agung kota bengkulu analisis lingkungan kerja fakultas keguruan ilmu pendidikan fkip universitas bengkulu evaluasi pelaksanaan program penanggulangan kemiskinan perkotaan p2kp pada kelurahan malabero kec teluk segara kota bengkulu tentang penggunaan pestisida pengaruhnya terhadap kesehatan masyarakat petani sayuran kabupaten rejang lebong in seminar nasional ptn bks 2010 2010 unpublished tentang penggunaan pestisida dampaknya terhadap kesehatan masyarakat petani sayuran kabupaten rejang lebong project report lembaga penelitian universitas bengkulu bengkulu unpublished penekanan nabati pada tanah tanaman tomat terkontaminasi fusarium oxysporum fsp lycopersici jipi 12 1 13 18 1411 0067 faktor faktor yang mempengaruhi dinamika kelompok tani kasus pada kelompok tani usaha lestari desa lubuk sanai kecamatan xiv koto kabupaten mukomuko pemanfaatan plasma nutfah lokal padi perlakuan suhu fotoperiod menggunakan teknik iradiasi sinar gamma menghasilkan kandidat mandul jantan project report lembaga penelitian universitas bengkulu unpublished indeks tekanan penduduk terhadap kawasan lindung valuasi ekonomi sumberdaya alam dengan contingent valuation methods cvm sebagai dasar arahan pengembangan wilayah berbasis konservasi sumberdaya alam kabupaten lebong agroekologi 25 1 237 245 1412 100x permodelan perencanaan pengembangan wilayah berbasis konservasi sumberdaya lahan dari aspek kelas kemampuan lahan in prosiding seminar nasional masyarakat konservasi tanah air indonesia universitas jambi jambi 626 640 978 602 97051 3 3 analisis efisiensi teknik usahatani padi pada dua tipologi yang berbeda propinsi bengkulu soca 10 1 33 39 1411 7177 supplementation of different levels of curcuma xanthorriza roxb in concentrate for lactating fh cows its effect on ration tdn produksi susu energi balans sapi fh yang disuplementasi tabut blok dengan level temulawak c xanthorrhiza roxb berbeda dengan konsentrat lengkap in prosiding semirata bidang ilmu ilmu pertanian bks ptn wilayah barat tahun 2010 fakultas pertanian universitas bengkulu bengkulu 941 946 978 602 96609 9 9 total digestible nutrient tdn sapi perah fh yang disuplementasi konsentrat pufa majalah ilmiah peternakan 3 2 50 55 0853 8999 produktivitas padi sawah pada kepadatan populasi berbeda jipi 12 1 49 54 1411 0067 the screening of fe2+ tolerant rice variety in new wetland field by using agronomy and physiology indices akta agrosia 13 1 16 23 1410 3354 pengaruh status sosial ekonomi terhadap percepatan recovery pemukiman pendaftaran varietas hasil pemuliaan jagung nda 143 f 5 pvhp 2011 perakitan varietas jagung hibrida berdaya hasil tinggi adaptif pada lahan masam podsolik merah kuning dengan dosis pemupukan yang rendah uji daya hasil lanjut multilokasi project report lembaga penelitian unib unpublished penampilan stabilitas hasil galur galur harapan kedelai pada dosis pupuk fosfor p rendah tiga lokasi bengkulu akta agrosia 13 1 50 54 1410 3354 kajian organoleptik kimia fisik kerupuk dengan penambahan tepung tulang ikan tenggiri agroekologi 26 2 287 291 1412 100x deteksi serologi virus penyebab penyakit mosaik pada tanaman cabai dengan das elisa serologycal detection of mosaic virus on chili crop by das elisa agriculture 17 1 626 630 1412 4262 eliminasi pineapple mealybug wilt associated virus pmwav dari tanaman nanas dengan hot water treatment jipi 12 1 19 25 1411 0067 fungsi kesenian dendang upacara adat perkawinan de sa gunung ayu kota manna bengkulu selatan jurnal penelitian lembaga penelitian unib 16 1 48 55 0852 405x analisis pelaksanaan promosi jabatan struktural pada kantor sekretariat dewan perwakilan rakyat daerah dprd provinsi bengkulu preliminary yield test of hybrid corn on ultisol under low input akta agrosia 13 1 70 76 1410 3354 peranan ccrr pemberian informasi kesehatan reproduksi terhadap remaja kota bengkulu pemotivasian kabag terhadap pegawai pada bagian pendidikan kerjasama universitas bengkulu efisiensi efektifitas kerja pegawai pada kantor kecamatan lebong utara kabupaten lebong survival penduduk sebagai dampak pemekaran wilayah kasus pada penduduk penerima ganti rugi lahan yang digunakan fasilitas fasilitas sosial desa talang saling kecamatan seluma kabupaten seluma persepsi orangtua siswa implementasi kebijakan pendidikan gratis kota bengkulu analisis pelayanan perizinan terpadu satu pintu pada kantor pelayanan perizinan terpadu kp2t provinsi bengkulu manajemen kesan pada anak jalanan menarik empati calon dermawan calon konsumen kota bengkulu pendekatan dramaturgis erving goffman pengaruh independensinsi gaya kepemimpinan komitmen organisasi pemahaman good governance terhadap kinerja auditor pemerintah pada auditor pemerintah bpkp perwakilan bengkulu in simposium nasional akuntansi xiii purwokerto 2010 fakultas ekonomi universitas jenderal soedirman purwokerto 1 25 978 602 97876 1 0 peranan guru mengembangkan keterampilan sosial anak autisme kasus sekolah pk plk mutiara bunda jalan gunung bungkuk bengkulu kontribusi geologi pembangunan kota wilayah bengkulu paska gempa bumi jurnal penelitian lembaga penelitian universitas bengkulu 16 1 21 27 0852 405x pola konsumsi pekerja seks komersial psk study kasus eks lokalisasi pulau baai kel sumber jaya kec kampung melayu kota bengkulu strategi peningkatan kepedulian mahasiswa terhadap fasilitas belajar mengajar akses 7 2 103 113 1693 8356 pengaruh pengetahuan sikap tekanan sosial motivasi berprestasi kontrol pribadi terhadap tindakan siswa mencapai kompetensi pelaksanaan penyaluran bantuan langsung tunai blt program kompensasi pengurangan bantuan bahan bakar minyak tahun 2007 2008 kelurahan pekan sabtu kota bengkulu water plant azolla sp as feed additive and the effect on production perfomance of broiler hubbard strain pendugaan regresi sequensial kasus multikolinear gradien 6 2 590 597 0216 2393 kajian morfologi struktur kulit biji raflesia dengan metode sem tahun kedua project report lembaga penelitian universitas bengkulu unpublished sikap warga dengan waria kecamatan bingin kuning kabupaten lebong teknik komunikasi petugas kesehatan pelaksanaan program jemput sehat warga pada puskesmas lingkar barat puskesmas nusa indah kota bengkulu efikasi insektisida nabati ekstrak daun tephrosia vogelii hook terhadap crocidolomia pavonana f plutella xylostella l serta pengaruhnya pada diadegma semiclausum hellen jipi 12 1 68 75 1411 0067 analisis perilaku seks mahasiswa universitas bengkulu prosiding seminar budidaya pertanian urgensi strategi pengendalian alih fungsi lahan pertanian 1 1 fakultas pertanian universitas bengkulu universitas bengkulu 978 602 19247 0 9 kesiapan usaha mikro kecil menengah industri kreatif mengadopsi teknologi informasi jurnal akutansi auditing indonesia 15 2 143 160 1410 2420 analisis penyampaian informasi pajak bumi bangunan pedesaan perkotaan pbb bea perolehan hak atas tanah bangunan bphtb pada dinas pendapatan daerah kabupaten rejang lebong hubungan gaya kepemimpinan dengan iklim komunikasi organisasi pt ferto rejang kota bengkulu implementasi peraturan pemerintah nomor 37 tahun 2007 tentang administrasi kependudukan kabupaten mukomuko kasus dinas kependudukan pencatatan sipil kabupaten mukomuko peranan kepala dinas mewujudkan efektivitas efisiensi transparansi dinas perindustrian perdagangan kota bengkulu pengar terhad t ruh per dap kepu rsonal utusan ie mart sophi selling n pembe tin kot g w elian pr ta beng word of roduk gkulu f mouth fashion h n analisis media komunikasi cetak sosialisasi undang undang lalu lintas nomor 22 tahun 2009 diversifikasi usaha nelayan tradisional memenuhi kebutuhan hidup pada musim paceklik pada nelayan kelurahan pasar bengkulu implementasi program bantuan sosial bagi para pekerja migran bermasalah sosial kota bengkulu study kasus dinas kesejahteraan sosial provinsi bengkulu analisis lingkungan kerja pada kantor dinas pendidikan nasional kota bengkulu kualitas pelayanan pt jasa raharja persero cabang bengkulu berdasarkan prinsip good corporate governance analisis film bebek belur dengan metode analisis semiotika roland barthes penerapan model pembelajaran koopeartif dengan memanfaatkan web blogspot sebagai media pembelajaran meningkatkan hasil belajar fisika siswa pada konsep suhu kalor kelas xe sman 06 kota bengkulu exacta 9 1 9 15 1412 3617 analisis kinerja unit pengelola keuangan desa upkd desa retak mudik kecamatan sungai rumbai kabupaten mukomuko interaksi etnis serawai dengan sumberdaya hutan orientasi nilai pada masyarakat peladang desa lubuk resam kecamatan seluma utara kabupaten seluma propinsi bengkulu analisis pelayanan izin pemanfaatan kayu rakyat ipkr dinas kehutanan kabupaten bengkulu selatan perubahan rangkaian upacara perkawinan adat daerah kaur utara dinamika remaja gaul desa tanjung tebat kecamatan tanjung tebat kabupaten lahat efektivitas lembaga ombudsman republik indonesia study kasus analisis hasil kerja ombudsman berdasarkan laporan tahun 2009 2010 pengaruh teknik komunikasi informatif yang dilakukan oleh pendidik sebaya terhadap tingkat pengetahuan remaja mengenai triad krr seksualitas napza hiv aids study kasus pada pik remaja merpati smk negeri 3 bengkulu peranan administrasi perkantoran optimalisasi pelayanan publik pada dinas perhubungan komunikasi informatika kabupaten bengkulu tengah analisis administrasi koleksi benda warisan sejarah alam museum negeri bengkulu analisis pelayanan kesehatan rumah sakit bagi pasien instalasi gawat darurat rawat inap rumah sakit umum daerah kaur analisis efektivitas fungsi pengawasan dewan perwakilan rakyat daerah dprd kota bengkulu strategi komunikasi pemasaran pemerintah daerah bengkulu mempromosikan pariwisata pengaruh fungsi account representative ar terhadap peningkatan kepatuhan wajib pajak wp pada wajib pajak orang pribadi wilayah kantor pelayanan pajak pratama bengkulu faktor faktor penyebab remaja melakukan perkosaan kota bengkulu kasus lembaga pemasyarakatan klas ii a kota bengkulu pengaruh kepemimpinan organisasi disiplin kerja terhadap prestasi kerja pegawai pada badan kepegawaian daerah kota bengkulu analisis partisipasi perempuan partai politik kasus pada partai demokrasi indonesia perjuangan pdi p partai keadilan sejahtera pks kota bengkulu analisis peningkatan kualitas pegawai rangka meningkatkan kualitas siaran lpp tvri bengkulu respon masyarakat terhadap pembangunan bandara mukomuko kabupaten mukomuko kasus upt ditjen perhubungan udara bandara mukomuko analisis kebijakan pemerintah daerah kabupaten kaur mengenai anggaran pada pemilukada tahun 2010 komunikasi organisasi antara pimpinan karyawan komunikasi internal antara pimpinan karyawan dealer honda pt nusantara surya sakti cabang bengkulu analisis kinerja satuan polisi pamong praja menertibkan pedagang kaki lima wilayah kota bengkulu analisis kinerja bagian humas pemerintah kota bengkulu komunikasi antar pribadi konselor dengan penderita hiv aids odha pada pelayanan vct voluntary counselling test hiv rs m yunus bengkulu strategi pemenangan pemilihan kepala daerah kasus pilkada kota bengkulu tahun 2007 analisis dampak sosial pertambangan pada masyarakat lokal kasus masyarakat desa penago baru kecamatan ilir talo kabupaten seluma pola asuh orang tua kepada pekerja anak dikawasan wisata tapak padri kasus dilakukan dikelurahan kebun keling kec teluk segara kota bengkulu comparison between the biology of learning model cooperative learning think pair share tps model with problem based learning instruction pbi smp 21 vii class city bengkulu exacta 9 2 1 7 1412 3617 antecedent and consequence of social computing behavior for social network sites perspective of social influence theory jurnal ekonomi bisnis indonesia 26 3 407 441 2085 8272 efektifitas penggunaan tv berbayar pengawasan orang tua terhadap peningkatan prestasi pendidikan anak pengaruh partisipasi anggota terhadap sisa hasil usaha pada koperasi mina berkah kelurahan pasar bengkulu kondisi sosial ekonomi petani karet rakyat kasus desa bukit paninjauaan i kec sukaraja kab seluma analisis perilaku anak yang menjadi bajing loncat sekitar pt batanghari bengkulu pratama pengaruh pengawasan melekat built in control terhadap kinerja penyuluh pertanian lapangan ppl pada dinas pertanian perkebunan kehutanan kabupaten bengkulu tengah peningkatan kualitas proses hasil pembelajaran matematika melalui penggunaan media benda konkret siswa kelas v sd negeri 15 padang ulak tanding ekonomi politik media televisi swasta nasional idea 5 20 49 56 1978 3531 komunikasi massa 100 hari sby‐jk in komunikasi massa 100 hari sby‐jk yayasan john hi‐tech idetama jakarta 35 40 029 analisis framing pemberitaan perseteruan antara kpk polri pada surat kabar harian nasional kompas periode 28 oktober 4 november 2009 orientasi pembelajaran sastra yang responsif gender smp negeri kota bengkulu triadik 14 1 1 10 8053 8301 strategi pengembangan usaha petani gula kelapa desa sumber makmur faktor faktor yang mempengaruhi implementasi kebijakan penyelenggaraan terminal karya jaya palembang akses 8 1 24 36 pengaruh menonton acara expedition metro tv terhadap tingkat pengetahuan mahasiswa pecinta alam kota bengkulu penampilan 10 genotipe kopi robbika budidaya dataran rendah pada tanaman menghasilkan tahun pertama in prosiding seminar perhimpunan ilmu pemuliaan tanaman indonesia peripi fakultas pertanian universitas andalas padang 288 294 978 602 1800607 idiotipe kopi arabika tanaman belum menghasilkan pada lingkungan dataran rendah menengah agrovigor 4 2 62 69 1979 5777 penampilan variabilitas sifat morfologi fisiologi biokimia karakteristik fisiologi biokimia kopi robbika pada dataran rendah in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian badan kerjasama perguruan tinggi negeri bks ptn wilayah barat fakultas pertanian unsri palembang 666 672 978 979 8389 18 4 silicone doped calcium phosphate powder synthesized via hydrothermal method in advances in materials engineering iium press malaysia 126 131 978 967 418 168 0 silicone doped calcium phosphate powder synthesized via hydrothermal method in advances in materials engineering iium press malaysia 126 131 978 967 418 168 0 synthesis and characterization of sol gel method derived zinc doped hydroxyapatite powder in advances in composite materials iium press malaysia 161 166 978 967 418 231 1 thermal analysis on hydroxyapatite synthesis through mechanochemical method in ifmbe proceedings biomed 2011 5th kuala lumpur international conference on biomedical engineering 2011 springer kuala lumpur malaysia 108 111 978 3 642 21728 9 hubungan gaya kepemimpinan dengan kinerja pegawai badan pusat statistik bps kota bengkulu perilaku komunikasi aktivis dakwah kampus perspektif dramaturgis kajian efisiensi tataniaga cabai merah pada pedagang pengecer kecamatan banyuasin iii kabupaten banyuasin sumatera selatan in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu interaksi masyarakat pada komunitas hindu kristen islam the effect of budgetaryon managerial performance through the organizational commitment and work motivation as the intervening variables in the 12th malaysia indonesia international conference on economics analisis etika pelayanan pegawai biro administrasi akademik kemahasiswaan perencanaan sistem informasi baakpsi universitas bengkulu pengembangan penilaian pembelajaran mendengarkan menumbuhkan pendidikan karakter berbahasa in prosiding bahasa sastra indonesia konservasi pendidikan karakter universitas negeri semarang semarang 539 553 978 602 9374 12 4 media darling impression faktor yang mempengaruhi alih fungsi lahan pangan menjadi kelapa sawit bengkulu kasus petani desa kungkai baru in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu akses keluarga miskin terhadap pelayanan kesehatan dasar perbandingan model logistik ordinal dengan model regresi klasik gradien 7 2 706 712 0216 2393 gaya kepemimpinan demokratis menunjang disiplin kerja pegawai pada sekretariat dewan perwakilan rakyat daerah kab musi rawas aplikasi teknologi akustik penentuan distribusi kelimpahan ikan pelagis pada musim barat perairan enggano bengkulu in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian ptn wilayah barat badan penerbitan fakultas pertanian unib bengkulu 1134 1141 978 979 8389 18 4 implementasi program p2kp meningkatkan pendapatan keluarga miskin kasus kelurahan tengah padang kecamatan teluk segara kota bengkulu hubungan antara alat bantu tangkap ikan dengan kesejahteraan nelayan dampak penggunaan pupuk hayati pada budidaya kedelai bawah tegakan sengon paraserianthes falcataria l nielsen lahan pasca penambangan batu bara in prosiding seminar nasional mikoriza pupuk pestisida hayati pendukung pertanian berkelanjutan yang ramah lingkungan fakultas pertanian universitas lampung bandar lampung 41 50 978 602 8616 94 2 mekanisme adaptasi genotipe baru kedelai mendapatkan hara fosfor dari tanah mineral masam jagronomi indonesia 39 1 24 30 peranan perempuan meningkatkan ekonomi keluarga dengan memanfaatkan sumberdaya pertanian agrisep 10 1 139 153 1412 8837 effects of feeding kroto aerophylla smaragdina kricket bra chytrypes membranaceus and diet combinations on live performance of young edible — nest swiftlet collocalia fuciphaga konflik pertanahan pada kawasan hutan lindung taman nasional kerinci seblat tnks pada komunitas suku bangsa rejang kabupaten lebong propinsi bengkulu akses 8 1 1 12 performances of sorghum genotypes under drought stress jurnal penelitian lembaga penelitian unib 17 1 21 24 0852 405x peran suami memenuhi kebutuhan keluarga penelitian pada pasangan suami istri yang bertempat tinggal terpisah desa sumber rejo kecamatan hulu palik kabupaten bengkulu utara hubungan penggunaan internet oleh mahasiswa universitas bengkulu dengan pemenuhan kebutuhan informasi akademik evaluasi kinerja pegawai negeri sipil pns bidang cipta karya dinas pekerjaan umum kabupaten bengkulu selatan konflik interpersonal lembaga program nasional pemberdayaan masyarakat mandiri pedesaan pnpm mp komunitas punk kota bengkulu the impact of internal marketing and customer orientation to service quality and their implication on customer satisf action of hospital service feasibility pembangunan pasar tradisional kabupaten bengkulu tengah project report lembaga penelitian universitas bengkulu unpublished feasibility pembangunan pusat perbelanjaan jajanan kawasan pantai panjang bengkulu project report lembaga penelitian universitas bengkulu begkulu unpublished kemampuan membaca cepat hambatan upaya pengembangannya "jurnal kepustakawanan masyarakat membaca" diterbitkan oleh upt perpustakaan universitas sriwijaya 27 2 23 38 0216 7808 keberdayaan kelompok perempuan nelayan pengetahuan lokal budidaya kayu bawang dysoxylum mollissimum blume kabupaten bengkulu utara agriculture 21 2 839 845 1412 4262 produktivitas seresah sonneratia alba sm hutan mangrove pulau baai bengkulu rafflesia 17 1 312 316 1411 2434 respon pertumbuhan semai jati putih gmelina arborea roxb terhadap perbedaan komposisi media tanam serbuk gergaji humanure sekam padi subsoil ultisol rafflesia 17 1 330 335 1411 2434 meningkatkan kemampuan guru membina karakter peserta didik melalui pembelajaran pkn dengan pendekatan pendidikan nilai triadik 14 1 29 35 8053 8301 pengaruh konsentrasi ragi terhadap volume etanol hasil fermentasi kulit buah pisang jantan musa paradisiaca var paradisiaca meningkatkan kreativitas seni lukis anak melalui kegiatan finger painting kelompok bermain paud bunga jempa uptd skb kabupaten lebong hambatan pelaksanaan jaminan kesehatan masyarakat jamkesmas rsud myunus bengkulu respon masyarakat terhadap program pusat kegiatan belajar masyarakat pkbm kasus pkbm sepakat desa ladang palembang kecamatan lebong utara kabupaten lebong analisis efektivitas pelaksanaan program ekonomi kerakyatan pemerintah kota bengkulu strategi humas upaya mengembalikan citra positif lembaga hukum ekses pertunjukan musik organ tunggal pada acara pernikahan optimalisasi pembelajaran kimia pemisahan melalui penerapan pendekatan konstruktivisme model peta konsep exacta 9 1 23 28 1412 3617 ozonolisis degradasi asam 2 4 iklorofenoksiasetat 2 4 d pestisida santamin 865 sl exacta 9 2 32 37 1412 3617 photolysis sonolysis and ozonolysis for degradation of 2 4 dichlorophenoxyacetic acid 2 4 d in proceeding international seminar on environmental science department of chemistry university of andalas padang sumatera barat 70 75 978 602 18475 0 3 desain umur bantalan carrier idler belt conveyor pt pelindo ii bengkulu jurnal teknik mesin 8 1 41 49 1829 8958 pengukuran fungsi respon frekuensi frf pada sistem poros rotor teknomekanik 3 2 144 151 1979 6102 pengaruh brand equity word of mouth communication terhadap keputusan membeli kosmetik penerapan metode cooperative learning tipe nht upaya meningkatkan keaktifan prestasi belajar siswa pada mata pelajaran pkn kelas iv sd negeri 06 bengkulu selatan putus sekolah pada anak anak usia wajib belajar 9 tahun kasus pada pekerja anak kawasan wisata tapak paderi kota bengkulu pelaksanaan hak kewajiban odha orang dengan hiv aids menjalani pelayanan kesehatan kasus pada odha dampingan yayasan kipas bengkulu analisis penerapan sistem manajemen keselamatan kesehatan kerja smk 3 pabrik pengolahan karet remah ppkr ptpn vii unit usaha padang pelawi kabupaten seluma analisis partisipasi masyarakat pelaksanaan program pnpm desa terusan kecamatan karang jaya kabupaten musi rawas marine chemistry of zirconium hafnium niobium and tantalum in international congress on analytical sciences 22 26 may 2011 kyoto japan strong elemental fractionation of zr hf and nb ta across the pacific ocean nature geoscience 1 4 1752 0894 perlindungan hukum terhadap hak cipta desain batik besurek ditinjau dari undang undang nomor 19 tahun 2002 bengkoelen justice 1 1 33 48 2088 3412 pemanfaatan jalur pantai pesisir sebagai peluang ekonomi produktif masyarakat penggunaan kit ipa melalui metode jigsaw meningkatkan prestasi belajar siswa pada materi pesawat sederhana kelas v sd negeri 46 bengkulu selatan tanda daftar varietas hasil pemuliaan cabai unib c gts1 2 pvhp 2011 upaya menurunkan bod cod limbah cair pengolahan kelapa sawit menggunakan mikroorganisme em4 serta pengaruhnya terhadap ph alkalinitas tradisi tabot sebagai medium pemersatu masyarakat kelurahan berkas kecamatan kota bengkulu akses 8 1 82 90 visualisasi adat asli pada ritual pernikahan cilok kai komik kebudayaan sebagai strategi pewarisan budaya bagi generasi muda project report lembaga penelitian unib unpublished slogan politik sebagai promosi kandidat calon kepala daerah bengkulu tengah posisi tawar peternak ayam ras pedaging pemodelan sistem panas bumi bawah permukaan dengan metode geolistrik tahanan jenis daerah prospek panas bumi gunungapi hulu lais bagian utara in seminar rapat tahunan bidang mipa badan kerjasama perguruan tinggi negeri bks ptn indonesia wilayah barat universitas lambung mangkurat kalimantan selatan kalimantan selatan 47 57 978 6 0298 9161 4 hubungan sosial etnis tionghoa dengan masyarakat pribumi sektor ekonomi pada etnis tionghoa kota bengkulu model bahan ajar matematika smp berbasis realistic mathematics education mengembangkan kemahiran matematika exacta 9 1 45 50 1412 3617 pendekatan problem posing pembelajaran matematika sekolah dasar triadik 14 1 55 63 8053 8301 peranan modal sosial penguatan ketahanansosial { ka$rs ll1*yar trrmurigrd dcrr mtfr bkti k€€anatan ketehun kbufrlcr efektivitas kebijakan pelayanan kesehatan gratis kota bengkulu pada tahun 2007 2009 penambahan ekstrak bawang merah pertumbuhan pembungaan seruni chrysanthemum sp in prosiding seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian ptn wilayah barat badan penerbitan fakultas pertanian unsri palembang 266 271 978 979 8389 18 4 agroforestry systems for sustaining rural development and protecting environmental quality in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu teknik komunikasi orang tua terhadap anak penyandang autis pada keluarga anak penyandang autis sekolah khusus layanan khusus mutiara bunda kota bengkulu analisis kualitas pelayanan perusahaan daerah air minum pdam kasus kecamatan ratu agung kota bengkulu mulsa organik pengaruhnya terhadap lingkungan mikro sifat kimia tanah keragaan cabai merah vertisol pada musim kemarau in prosiding seminar nasional perhimpunan hortikultura indonesia ipb bogor balitsa lembang 122 128 978 979 25 1264 9 mengembangkan kreativitas siswa melalui pembelajaran matematika dengan pendekatan inkuiri triadik 14 1 11 18 8053 8301 upaya meningkatkan hasil belajar matematika melalui penerapanpendekatan kooperatif tipe think pair share tps pada kelas iv sd negeri 3 kaur selatan penerapan model pembelajaran kooperatif tipe numbered head together nht dengan metode problem solving meningkatkan kualitas proses hasil belajar matematika ptk kelas va sdn 09 kota bengkulu anai isis tingx at pe\cftahuan tingxai pindidikan ibu d^t am pem'irian maxantn pendampd{g asi i fr asi dibawtii usia 6 [ut an pengaruh komunikasi persuasif sales force terhadap keputusan pembelian oleh konsumen pt prioritas bengkulu analisis kepuasan kerja pegawai bidang pasar pad a dinas perindustrian perd aga n gan kota bengkulu analisis kinerja tim penyusun rencana program investasi jangka menengah rpijm pemerintah kota bengkulu pada bidang pekerjaan umum cipta karya analisis fungsi camat koordinasi pelaksanaan pembangunan pada kecamatan sindang kelingi kabupaten rejang lebong perakitan galur padi gogo toleran kekeringan tahan blas berdaya hasil tinggi varietas unggul lokal bengkulu melalui kultur antera project report lembaga penelitian universitas bengkulu unpublished faktor penghambat proses pembebasan tanah proyek perkebunan pt agricinal desa petai kayu kecamatan semidang alas kabupaten seluma laporan hasil penelitian perakitan hibrida unggul toleran virus sebagai upaya mengatasi serangan cucumber mosaic virus pada cabai merah seleksi menggunakan marka molekuler project report lembaga penelitian universitas bengkulu bengkulu kontribusi norma hukum adat pembaharuan tindak pidana korupsi indonesia supremasi hukum 2 20 1 18 1693 766x peningkatan kualitas lahan bekas tambang melalui revegetasi kesesuaiannya sebagai lahan pertanian tanaman pangan in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu menanamkan nilai nasionalisme melalui pembelajaran pendidikan pancasila kewarganegaraan ptk pada siswa kelas vi sdn 88 perumnas unib bentiring triadik 14 1 84 91 8053 8301 laju subsiden pada sistem drainase pengapuran tanah gambut fibrik dengan pertanaman jagung in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu pelaksanaan undang undang kerajaan melayu sastra sejarah aspek adat naskah sejarah melayu triadik 14 1 64 75 8053 8301 analisis peran dinas pendidikan implementasi manajemen berbasis sekolah mbs tingkat pendidikan dasar study deskriptif kualitatif pada dinas pendidikan kabupaten bengkulu tengah analisis pelaksanaan pajak bumi bangunan bengkulu utara pada kantor pelayanan pajak pratama argamakmur upaya peningkatan kualitas perkuliahan dasar dasar pendidikan mipa melalui penerapan pendekatan konstruktivisme dengan pembelajaran kooperatif tipe team games tournament exacta 9 1 51 59 1412 3617 aktualisasi nilai nilai pendidikan karakter penokohan cerpen serial abu nawas surat kabar rakyat bengkulu strategi pencegahan alih fungsi lahan melalui penerapan modernisasi budidaya pengolahan kelapa terpadu wilayah perbatasan utarakalimantan timur malaysia in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu pengaruh rasio profitabilitas rasio likuiditas dividend payout ratio dpr indikator pasar terhadap harga saham pada perusahaan industri makanan minuman pemaknaan pesan pada upacara ritual ngantung buay analisis kapital social keluarga kelurahan lempuing kota bengkulu pengurangan risiko bencana akses 8 2 120 135 1693 8356 implementasi metode frame mendiagnosa gangguan kepribadian dramatik menggunakan sistem pakar in prosiding snati universitas islam indonesia yogyakarta 32 36 1907 5022 analisis efektivitas organisasi dinas pertamanan kebersihan kota bengkulu pengelolaan kebersihan pola produksi distribusi konsumsi keluarga pada petani kopi meningkatkan kemampuan membaca melalui metode fonik menggunakan papan slip pada anak kelompok b1 taman kanak kanak tadika puri kepahiang laporan hasil penelitian pemetaan pengembangan mutu pendidikan ppmp hasil ujian nasional sma kab bengkulu selatan kab seluma propinsi bengkulu project report lembaga penelitian universitas bengkulu bengkulu terabaikannya potensi strategis kelompok transient poor kebijakan analisis csis 40 3 344 374 1829 5908 meneliti perempuan bangsa sendiri negeri asing suatu refleksi metodologis in akses keadilan migrasi global yayasan pustaka obor indonesia jakarta 106 132 978 979 461 782 3 tekanan penduduk trend perubahan penggunaan lahan potensial pertanian kota singkawang kalimantan barat in fakultas pertanian universitas bengkulu 07 juli 2011 seminar nasional budidaya pertanian analisis implementasi program quick win keberhasilan segera bidang pelayanan sim stnk bpkb pada kantor samsat bengkulu pengenalan konsep bilangan dengan menggunakan media pohon pintar pada anak kelompok b2 tk negeri pembina ketahun analisis kualitas pelayanan jamkesmas jamkesda puskesmas sindang dataran kabupaten rejang lebong analisis efektivitas pelaksanaan perda no 09 tahun 1999 tentang retribusi pasar pada dinas perindustrian perdagangan kota bengkulu partisipasi masyarakat pembangunan desa kasus program bantuan pemberdayaan masyarakat desa desa ftrikoyo kecamatan tugumulyo kabupaten musi rawas evaluasi kegiatan kehumasan membangun relasi dengan media peran komite sekolah pengelolaan pendanaan pendidikan sesuai peraturan pemerintah nomor 48 tahun 2008 kasus komite sekolah pada sma negeri 1 pondok kelapa kabupaten bengkulu tengah interaksi genotipa x lingkungan jaguing hibrida lahan masam ultisol pada kondisi input rendah in prosiding seminar perhimpunan ilmu pemuliaan indonesia peripi universitas andalas padang 114 119 978 602 1 80067 simulasi pemanfaatan panas buang chiller kebutuhan air panas perhotelan jurnal teknik mesin 8 2 94 102 1829 8958 analisa kinerja engine turbofan cfm56 3 jurnal teknik mesin 8 2 78 82 1829 8958 pola pemupukan pemulsaan pada budidaya sawi etnik toraja pulau tarakan in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu konsep diri komunikasi interpersonal mantan pengguna narkoba pada mantan pengguna narkoba yang telah berhasil pulih hidup normal kota bengkulu pengembangan teknologi penyelamatan embrio cemara laut casuarina equisetifolia sebagai upaya pelestarian kawasan konservasi wilayah pesisir kota bengkulu project report lembaga penelitian universitas bengkulu unpublished pembentukan kalus embriogenik pisang ‘curup unggulan bengkulu pada kultur bunga jantan male flower in poster pada pameran bazar womens expo 8 10 maret 2011 bengkulu unpublished stimulasi pembentukan planlet pisang ambon curup unggulan bengkulu melalui pembentukan embrio somatik pada kultur bunga jantan male flower tahun pertama project report lembaga penelitian universitas bengkulu unpublished analisis implementasi kebijakan pengendalian pencemaran sungai air bengkulu oleh badan lingkungan hidup provinsi bengkulu tingkat pengetahuan masyarakat terhadap undang undang no 23 tahun 2004 tentang penghapusan kekerasan rumah tangga kasus kecamatan gading cempaka kota bengkulu meningkatkan kecerdasan logika matematika anak melalui permainan konstruktif pada kelompok b2 taman kanak kanak mu amalah kepahiang analisis penerapan kode etik jurnalistik pwi pada pemberitaan hukum kriminal surat kabar harian rakyat bengkulu bengkulu ekspress radar bengkulu edisi bulan februari 2011 pengembangan model siklus belajar learning cycle meningkatkan kemampuan penguasaan aplikasi konsep pengembangan model pembelajaran bidang sains sekolah dasar exacta 9 2 51 58 1412 3617 hubungan aktivitas komunikasi antarpribadi pembina asrama dengan mahasiswa menjalin hubungan yang harmonis respon masyarakat sekitar tambang terhadap pembangunan pertamina geotermal energi hulu lais kasus kelurahan taba anyar kecamatan lebong selatan farmers are sacrificing their health for production of vegetables in proceeding international conference on sustainable agriculture and food security challenges and opportunities universitas padjadjaran bandung 141 149 978 979 8246 12 8 meningkatkan kemampuan berhitung anak melalui metode bermain media alami pada kelompok bi tk mekar indah kota bengkulu ketahanan keluarga pada pasangan suami istri tki modal sosial pada komunitas nelayan pulau baai pada nelayan kelurahan sumber jaya kecamatan kampung melayu kota bengkulu akses 8 1 55 63 pola sosialisasi pengetahuan nilai nilai tentang laut pada nelayan tradisional melayu kota bengkulu akses 8 2 136 155 1693 8356 etos kerja penduduk lokal transmigran meningkatkan kemampuan berhitung anak melalui permainan kartu angka kelompok b2 tk aisyiyah busthanul athfal muara aman lebong penelitian tindakan kelas ptk pengembangan integrated farming system pengendalian alih fungsi lahan pertanian in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu prasangka sosial interaksi antara suku rejang dengan suku jawa study kasus desa nangai amen kecamatan lebong utara kabupaten lebong analisa penyelesaian kegiatan pembukaan perkebunan kelapa sawit pt desaria plantation mining kaur bengkulu aplikasi metoda pert cpm agribis 3 1 271 277 2086 7956 dampak mekanisasi pertanian terhadap komunikasi antara petani pemilik dengan buruh tani komunikasi antarpersonal panitera muda gugatan atau permohonan terhadap pencari keadilan melayani prosedur berperkara komunikasi persuasif orang tua menumbuhkan motivasi belajar pada anak pengembangan kelembagaan mikro kredit berbasis komunitas sebagai upaya penanganan kemiskinan perkotaan kelurahan pasar minggu kecamatan pasar minggu jakarta selatan akses 8 1 64 81 peningkatan hasil pembelajaran ipa materitumbuhan hijau melalui metode eksperimen pada siswa kelas v sd negeri 02 kaur utara methods for breeding glyphosate resistant plants and compositions thereof us7906709 b2 peng oran garuh ng tua rem h kom a asuh maja p panti a bengk munika h terh asuha kulu asi int hadap an kha selat terpe p kon airun tan ersona nsep nissa d al iri decentralisation and national integration in indonesia a case study of post new order riau lap lambert academic publishing germany 978 3844317688 perilaku masyarakat miskin kota bengkulu model pengentasan kemiskinan berbasis nilai sosial budaya lokal jurnal masyarakat kebudayaan politik 24 2 2086 7050 perilaku masyarakat miskin kota bengkulu model pengentasan kemiskinan berbasis nilai sosial budaya lokal media masyarakat kebudayaan politik 24 2 151 161 2086 7050 pendistribusian bantuan kompor gas kota bengkulu pemihakan pada masyarakat miskin project report lembaga penelitian unib unpublished model akuntabilitas tata kelola cagar alam danau dusun besar bengkulu berbasis pemangku kepentingan project report lembaga penelitian unib unpublished pelaksanaan marketing public relations rumah sakit rafflesia bengkulu pengaruh rubrik modifikasi tabloid ‘motorplus terhadap kreatifitas memodifikasi motor pada klub bhmc bengkulu honda motor club kota bengkulu alih fungsi lahan pertanian merupakan suatu kebutuhan atau tantangan in prosiding seminar nasional budidaya pertanian urgensi strategi pengendalian alih fungsi lahan pertanian jurusan budidaya pertanian fakultas pertanian unib bengkulu 207 225 978 602 19247 0 9 jenis cacing nematoda yang menginfeksi anak usia sekolah dasar sd 08 desa harapan makmur kecamatan pondok kubang kabupaten bengkulu tengah faktor faktor penyebab pernikahan siri kelurahan sukaraja kecamatan sukaraja kabupaten seluma propinsi bengkulu makna upacara ritual kematian kajian tentang interaksi simbolik pada etnis tionghoa palembang sumatra selatan analisis kualitas pelayanan pasien rawat inap rumah sakit bhayangkara jitra polda bengkulu analisis kinerja pegawai negeri sipil kantor pelayanan perizinan terpadu kppt kabupaten kepahiang analisis kondisi kesejahteraan keluarga pengumpul batubara dikelurahan beringin raya kecamatan muara bangkahulu kota bengkulu strategi bertahan hidup keluarga petani karet miskin desa terpencil memenuhi kebutuhan pokok keluarga kasus desa muara kuis kec ulu rawas kab musi rawas sumatra selatan penerapan pembelajaran tematik dengan menggunakan metode think pair share tps melalui permainan talking stick ts meningkatkan hasil belajar siswa kelas ii sd negeri 40 kota bengkulu pengaruh tayangan iklan kosmetik pond s white beauty terhadap sikap siswi smkn memiliki kulit putih strategi pemenuhan kebutuhan dasar petani miskin kelurahan sukamerindu kecamatan sungai serut kota bengkulu analisis disiplin kerja petugas pelayanan kesehatan pasien bagian instalansi gawat darurat rumah sakit umum daerah dr myunus provinsi bengkulu kebijakan penanggulangan kemiskinan kelurahan kemas rindo kecamatan kertapati palembang tentang pedagang kaki lima akses 8 1 13 21 penggunaan jam dinding sebagai media meningkatkan aktifitas prestasi belajar siswa kelas iv mata pelajaran matematika materi pokok pengukuran sudut madrasah ibtidaiyah negeri nanjungan kabupaten bengkulu selatan penerapan tutor sebaya mengaktifkan meningkatkan hasil belajar mahasiswa pada pelaksanaan kuliah antar semester mata kuliah kalkulus integral exacta 9 2 25 31 1412 3617 penggunaan geometer's sketchpad meningkatkan keaktifan prestasi belajar mahasiswa pada mata kuliah kalkulus integral in prosiding seminar rapat tahunan bidang ilmu mipa semirata bks ptn b universitas lambung mangkurat banjarmasin 978 6 0298 9161 4 laporan penelitian pembinaan komunitas ekosistem terumbu karang pulau tikus bengkulu project report lembaga penelitian universitas bengkulu bengkulu upaya menstimulasi kecerdasan logika matematikaanak melalui bermain maze mencari jejak pada kelompok b paud taman islam kota bengkulu penggunaan metode kooperatif learning tipe stad student team achiement division peningkatan hasil belajar pada mata pelajaran sains kelas iv sekolah dasar negeri 40 bengkulu selatan female participation in the labor market in bengkulu city in the 12th malaysia indonesia international conference nn economics perilaku petani usahatani padi lahan rawa lebak in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu efisiensi penggunaan pupuk lahan upaya meningkatkan produktivitas padi sawah in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu penggunaan batu kapur super lolos #325 sebagai filler pengganti pada campuran split mastic asphalt grading 0 11 inersia jurnal teknik sipil 2 2 42 48 2086 9045 evaluasi pelaksanaan program desa siaga desa dusun curup kecamatan air besi kabupaten bengkulu utara strategi bertahan hidup keluarga pemulung tempat pembuangan akhir tpa air sebakul kelurahan sukarami kecamatan selebar kota bengkulu efektivitas pengawasan disiplin pegawai pada sub bagian penataan ruang dinas pekerjaan umum provinsi bengkulu pengaruh tayangan iklan layanan masyarakat pertamina terhadap pemakaian gas lpg kota bengkulu kasus pada pemakaian kompor gas kecamatan muara bangkahulu kinerja aparatur kecamatan memberikan pelayanan administrasi kependudukan kecamatan lebong atas kabupaten lebong persepsi mahasiswa ilmu komunikasi tentang adegan kekerasan penayangan opera van java mafia pupuk adalah kejahatan sistemik teror inspirasi 2 33 p 1 metode cepat penilaian kesehatan tanah dengan indikator kinerja tanah in seminar nasional rapat tahunan dekan bidang ilmu ilmu pertanian 23 25 mei 2011 palembang pengaruh model pembelajaran multikultur terhadap empati sosial siswa sd triadik 14 1 45 54 8053 8301 kendala kognitif mahasiswa pendidikan fisika fkip universitas bengkulu pada sejumlah konsep dasar fisika exacta 9 2 80 87 1412 3617 pembagian kerja berdasarkan gender sistem produksi distribusi konsumsi pada keluarga petani kopi kualitas pelayanan kantor cabang bri manna bengkulu selatan petanda oligonuleotida acttaattgggagccatata berlabel biotin deteksi dini kelainan genetik spindylo epiphyseal dysplasia tarda sedt bengkulu universitas bengkulu bengkulu alteration of ossification rate on fetal humerus and femur swiss webster mice mus muculus as the teratogenic effects of gadung dioscorea hispida dennts medika 37 9 596 603 0126 0901 keterampilan menulis puisi dengan observasi lingkungan sekolah pada siswa kelas v tuna grahita ringan slb negeri musi rawas korelasi pengetahuan alat praktikum fisika dengan kemampuan psikomotorik siswa sma negeri q kota bengkulu exacta 9 1 67 76 1412 3617 stra ategi a mem e daptas enuhi k si ekon kebutu nomi ne uhan d elayan dasar k n miski keluar in dala rga am dampak alih fungsi lahan sawah terhadap ketahanan pangan beras in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu penerapan model kooperatif tipe stad pada mata pelajaran pkn meningkatkan kualitas proses pembelajaran kerjasama siswa kelas ivb sd negeri 02 kota bengkulu pengaruh iklan media luar ruang billboard jam belajar terhadap sikap pelajar mensukseskan bengkulu kota pelajar kasus pada pelajar smp n 11 smp n 1 kota bengkulu geometri bintang berotasi pada keadaan kritis in prosiding seminar nasional fisika universitas andalas snfua 2011 jurusan fisika universitas andalas padang 144 153 978 979 25 1953 2 hubungan komunikasi terapeutik perawat pelayanan keperawatan dengan kepuasan pasien rawat inap rumah sakit rafflesia kota bengkulu pemanfaatan asap cair mempertahankan kesegaran buah pisang ambon curup agro industri 1 1 8 16 2088 5369 kajian dua macam bahan organik jarak tanam terhadap pertumbuhan hasil tanaman padi gogo in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu adopsi petani terhadap sistem rice intentifaction sri desa bukit peninjauan i kecamatan sukaraja kabupaten seluma agribis 4 2 279 285 2086 7956 hubungan antara penerimaan sosial kelompok kelas dengan kepercayaan diri pada siswa kelas i sltp xxx jakarta triadik 14 1 37 44 8053 8301 optimalisasi kualitas tayangan berita btv terhadap kepuasan pemirsa persepsi khalayak terhadap image djarum coklat iklan yang menggunakan celebrity endorser revitalisasi kelompok kerja guru guna meningkatkan kompetensi profesionalisme guru sd mi kabupaten seluma triadik 14 1 19 28 8053 8301 pen blan garuh k terh h berm hadap main g p kegi game o iatan b online belaj e poin jar an nt a k pr rasangk ka sosia al anta ara masy dengan n pribum yaraka mi at tiong ghoa upaya peningkatan hasil belajar dengan penerapan metode inkuiri terbimbing tipe a pada konsep kalor siswa kelas vii smp n 5 seluma exacta 9 1 38 44 1412 3617 pemetaan potensi status kerusakan tanah mendukung produktivitas biomassa kabupaten lebong in seminar nasional budidaya pertanian 07 juli 2011 fakultas pertanian universitas bengkulu competitiveness and minimum regional price of arenga palm sugar in proceeding exploring research potentials the counsil of rector of indonesian state university crisu and the counsil of university president of thailand cupt sriwijaya university palembang 978 979 98938 5 7 competitiveness and minimum regional price of arenga palm sugar case study of small palm sugar in dust ries in rejang lebong regency bengkulu province in proceeding o f t he international sem ina r p alembang 2 0 2 2 october 2 01 1 fakultas pertanian unsri unsri palembang 91 97 9789799893857 kualitas pelayanan pembuatan surat tanda bukti hak menempati stbhm pada dinas perindustrian perdagangan kota bengkulu pengaruh erosivitas hujan yang diperoleh dari rumus yang berbeda terhadap pemodelan erosi berbasis raster kasus das merawu banjarnegara jawa tengah agritech 31 3 250 259 0216 0455 penginderaan jauh digital terapannya pemodelan erosi berbasis raster in penginderaan jauh digital terapannya pemodelan erosi berbasis raster lokus yogyakarta 1 35 978 602 97622 6 6 hubungan faktor akses layanan resiko kenyamanan serta kesepakatan pria dengan pasangan bergaining dengan partisipasi pria pemakaian alat kontrasepsi supplementation of concentrate with different levels of temulawak c xanthorrhiza roxb on milk production of lactating frisien holland cows in proceedings of the second international symposium on temulawak biopharmaca research center bogor agricultural university bogor 116 120 978 979 25 1209 0 dampak pembangunan pariwisata pantai terhadap perubahan nilai nilai sosial teratogenitas senyawa flavonoid ekstrak metanol daun benalu dendrophthoe pentandra l miq pada mus musculus exacta 9 1 1 8 1412 3617 uji aktivitas senyawa flavonoid total dari gynura segetum lour terhadap peningkatan eritrosit penurunan leukosit pada mencit mus musculus exacta 9 2 8 16 1412 3617 pendaftaran varietas hasil pemuliaan jagung unib c38 7 pvhp 2011 perakitan varietas jagung berdaya hasil tinggi adaptif pada lahan masam podsolik merah kuning dengan dosis pemupukan yang rendah uji daya hasil lanjut uji multilokasi project report lembaga penelitian universitas bengkulu bengkulu tanda daftar varietas hasil pemuliaan jagung mita 1522 4 pvhp12011 tanda daftar varietas hasil pemuliaan jagung suto 71 6 pvhp 2011 efektifitas komunikasi upaya penyebarluasan penggunaan obat tradisional herbal kota bengkulu project report lembaga penelitian universitas bengkulu unpublished analisis dampak proyek pengembangan aplikasi grameen bank meningkatkan status sosial ekonomi perempuan nelayan kecamatan teluk segara kota bengkulu akses 8 1 37 54 analisis efisiensi ekonomis penggunaan faktor produksi pada usahatani jagung hibrida kecamatan kumpeh kabupaten muaro jambi in prosiding semirata bidang ilmu pertanian bks ptn wilayah barat tahun 2011 fakultas pertanian unsri palembang 317 325 978 979 8389 18 4 galur galur harapan kedelai keturunan persilangan varietas malabar kipas putih penampilan pada dua dosis pupuk fosfor p in prosiding seminar perhimpunan ilmu pemuliaan tanaman indonesia peripi fakultas pertanian universitas andalas padang 89 95 9786021800607 tanda daftar varietas hasil pemuliaan unib k gds4 komunitas waria pekerja salon pembuatan mie basah berkalsium dengan penambahan tulang ikan tenggiri somberomorus lineolatus agro industri 1 1 36 45 2088 5369 analisis peran taruna siaga bencana tagana pada pencegahan penanganan korban bencana alam gempa bumi study deskriptif desa pal 30 kecamatan lais kabupaten bengkulu utara model akselerasi rehabilitasi lahan terdegradasi menuju pembangunan hutan tropis yang produktif project report lembaga penelitian universitas bengkulu bengkulu unpublished pengaruh kesetaraan gender terhadap perekonomian daerah kasus kabupaten musi rawas provinsi sumatera selatan tahun 2000 2009 jurnal ekonomi perencanaan pembangunan 4 1 9 15 1979 7338 implementasi analisa kinerja algoritma ant system as penyelesaian multiple travelling salesman problem mtsp in prosiding snati 2011 uii yogyakarta 48 54 1907 5022 pembelajaran medan magnet menggunakan online interactive multimedia meningkatkan penguasaan konsep keterampilan berpikir kritis mahasiswa in prosiding seminar banjarmasin 2011 banjarmasin banjarmasin 978 6 0298 9161 4 submitted penggunaan multimedia interaktif pada pembelajaran medan magnet meningkatkan keterampilan generik sains mahasiswa exacta 9 1 60 466 1412 3617 eliminasi pmwav pada eksplan nanas dengan perlakuan air panas pengaruhnya terhadap viabilitas eksplan rafflesia 18 2 419 423 1411 2434 analisis pelaksanaan program usaha peningkatan pendapat keluarga up2k bagi kader pkk lembaga dakwah kampus komunitas eksklusif peningkatan kualitas pembelajaran pkn sekolah dasar melalui model pembelajaran bermain peran perspektif 24 15 108 112 1411 5255 pemanfaatan status kawasan pantai sebagai daerah tujuan wisata meningkatkan pendapatan ekonomi keluarga nelayan upaya menumbuhkan kemampuan membaca permulaan melalui media bermain lempar dadu huruf kelompok b1 tk yasporbi kota bengkulu penelitian tindakan kelas sistem tata kelola database sekolah dasar menengah propinsi bengkulu in prosiding knsi konferensi nasional sistem informasi 2011 information system bridging gap between theories and practices stmik potensi utama medan medan 237 242 978 602 98768 0 2 peningkatkan hasil pembelajaran ilmu pengetahuan alam ipa pada materi bagian tubuh tumbuhan melalui metode inkuiri terbimbing siswa kelas iv sd negeri 01 kaur utara hubungan antara motivasi belajar dengan prestasi belajar matematika pada siswa kelas iv sd negeri gugus ii efektifitas komunikasi interpersonal dosen pembimbing akademik peningkatan motivasi belajar mahasiswa pada proses bimbingan akademik pada fakultas ilmu sosial politik universitas bengkulu analisis kinerja pegawai meningkatkan produktivitas kerja implementasi reformasi pendidikan pada smp negeri kota bengkulu triadik 14 1 76 83 8053 8301 peningkatan penguasaan konsep melalui pembelajaran dengan strategi problem solving pada topik optika bagi mahasiswa pendidikan fisika pengaruh daya tarik tayangan infotainment cek & ricek rcti terhadap minat menonton ibu rumah tangga penyiapan perempuan menghadapi masa menopause analisis framing sebagai instrumen penanganan konflik pengelolaan sumberdaya alam in the repotition of communication in the dynamic of convergence reposisi komunikasi dinamika konvergensi kencana jakarta 540 555 978 602 9413 00 7 introduction of system of rice intensification sri in kelara karalloe in south sulawesi indonesia idea 5 20 26 35 1978 3531 peningkatan daya saing pisang ambon curup melalui strategi branding peningkatan nilai jual tape singkong melalui penerapan value creation strategy peningkatan kemampuan kognitif anak kelompok b2 taman kanak kanak yasporbi kota bengkulu melalui permainan memancing ikan analisis kebijakan pengembangan objek wisata pantai panjang kota bengkulu analisis implementasi program transmigrasi umum rangka peningkatan pendapatan transmigran kasus upt muara santan sp 2 kabupaten bengkulu utara pembentukan precipitated calcium carbonate pcc dengan penambahan hno3 proses slaking pada metoda karbonasi in seminar rapat tahunan bidang ilmu mipa fmipa universitas lambung mangkurat banjarmasin peran satuan polisi pamong praja penegakan peraturan daerah nomor 3 tahun 2008 tentang ketentraman ketertiban umum kota bengkulu penerapan strategi pembelajaran keong mengoptimalkan penguasaan konsep bilangan irrasional mahasiswa pendidikan matematika universitas bengkulu exacta 9 1 peran perempuan pelaksanaan tugas legislasi anggaran pengawasan terkait permasalahan perempuan hubungan cara belajar kebiasaan belajar dengan prestasi belajar mahasiswa kasus mahasiswa sosiologi universitas bengkulu model komunikasi orang tua membangun rasa percaya diri anak penyandang cacat fisik peningkatan hasil belajar siswa dalamperubahan wujud benda dengan menggunakan metode pbl alat peraga sd negeri 10 kaur selatan analisis kinerja karyawan pt pos indonesia persero cabang bengkulu temperature and relative humidity gains of teko bersayap model solar dryer a research note in proceedings of international seminar a comprehensive review of trading strategies in search an exellent strategy for traders in the indonesia stock exchange in proceedings miicema borderless economy opportunities and challenges for business in southeast asia strategy in stock trading with home online trading systems hots efektivitas pelaksanaan corporate social responsibility csr oleh pt pln persero w s2jb cabang bengkulu meningkatkan kecerdasan logika matematika menggunakan media permainan tangga angka pada kelompok a1 taman kanak kanakwitri 1 kota bengkulu komunikasi antarpribadi orang tua dengan anak remaja pembentukan konsep diri penerapan sistem komputerisasi meningkatkan efektivitas kerja karyawan pada pt jamsostek persero cabang bengkulu
continue reading Jurnal Indonesia 004